Transcript: Human XR_001742516.1

PREDICTED: Homo sapiens uncharacterized LOC107986383 (LOC107986383), ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC107986383 (107986383)
Length:
919
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001742516.1
NBCI Gene record:
LOC107986383 (107986383)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001742516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018549 AGGACGAACCACAGAGAAGAT pLKO.1 387 3UTR 100% 4.950 2.475 Y HMGN2 n/a
2 TRCN0000018548 CCCTGCAAAGAAGGGAGAGAA pLKO.1 465 3UTR 100% 4.950 2.475 Y HMGN2 n/a
3 TRCN0000018552 GACCAGGCACAGAAAGCTGAA pLKO.1 565 3UTR 100% 4.050 2.025 Y HMGN2 n/a
4 TRCN0000018550 GAGAAGGTACCCAAAGGGAAA pLKO.1 481 3UTR 100% 0.000 0.000 Y HMGN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001742516.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00754 pDONR223 100% 27.4% None (many diffs) n/a
2 ccsbBroad304_00754 pLX_304 0% 27.4% V5 (many diffs) n/a
3 TRCN0000465397 CGTGTAGCACCTTCTGGCTCTCTA pLX_317 100% 27.4% V5 (many diffs) n/a
Download CSV