Transcript: Human XM_017011502.1

PREDICTED: Homo sapiens QKI, KH domain containing RNA binding (QKI), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
QKI (9444)
Length:
4417
CDS:
59..1072

Additional Resources:

NCBI RefSeq record:
XM_017011502.1
NBCI Gene record:
QKI (9444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233374 TAGGTGCGGTGGCTACTAAAG pLKO_005 990 CDS 100% 10.800 15.120 N QKI n/a
2 TRCN0000015186 CCGAAGCTGGTTTAATCTATA pLKO.1 894 CDS 100% 13.200 10.560 N QKI n/a
3 TRCN0000233373 CCGAAGCTGGTTTAATCTATA pLKO_005 894 CDS 100% 13.200 10.560 N QKI n/a
4 TRCN0000233371 CTGATGCTGTGGGACCTATTG pLKO_005 276 CDS 100% 10.800 8.640 N QKI n/a
5 TRCN0000015183 GCTACATCAATCCTTGAGTAT pLKO.1 947 CDS 100% 4.950 3.960 N QKI n/a
6 TRCN0000233372 GAAGCAGAAACCGGATGTAAA pLKO_005 398 CDS 100% 13.200 9.240 N QKI n/a
7 TRCN0000015184 CCCTACCATAATGCCTTTGAT pLKO.1 802 CDS 100% 5.625 3.938 N QKI n/a
8 TRCN0000015185 AGAAACTTTATGTGCCTGTAA pLKO.1 309 CDS 100% 4.950 3.465 N QKI n/a
9 TRCN0000015187 GACGAAGAAATTAGCAGAGTA pLKO.1 194 CDS 100% 4.950 3.465 N QKI n/a
10 TRCN0000102407 GCACCAGCTACATCAATCCTT pLKO.1 941 CDS 100% 3.000 2.100 N Qk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02164 pDONR223 100% 98.6% 98.5% None 1010_1011delGTinsCCGCCACCGGCAAC n/a
2 ccsbBroad304_02164 pLX_304 0% 98.6% 98.5% V5 1010_1011delGTinsCCGCCACCGGCAAC n/a
3 TRCN0000467894 CCTGACTCCGTGTACCCTTCACCC pLX_317 41.9% 98.6% 98.5% V5 1010_1011delGTinsCCGCCACCGGCAAC n/a
Download CSV