Transcript: Human XM_017023894.1

PREDICTED: Homo sapiens SLC9A3 regulator 2 (SLC9A3R2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC9A3R2 (9351)
Length:
2764
CDS:
604..1722

Additional Resources:

NCBI RefSeq record:
XM_017023894.1
NBCI Gene record:
SLC9A3R2 (9351)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017023894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043703 CGAGACAGATGAACACTTCAA pLKO.1 1431 CDS 100% 4.950 6.930 N SLC9A3R2 n/a
2 TRCN0000043704 GAAGCGTGAAATCTTCAGCAA pLKO.1 1695 CDS 100% 2.640 3.696 N SLC9A3R2 n/a
3 TRCN0000043706 GTCCTGCCATTGCCCAGAAAT pLKO.1 1822 3UTR 100% 13.200 9.240 N SLC9A3R2 n/a
4 TRCN0000443729 ACCTCAGGGCTATGGGTTCAA pLKO_005 1212 CDS 100% 4.950 3.465 N SLC9A3R2 n/a
5 TRCN0000445040 AGACCCAGAGATGTGAGAGAG pLKO_005 1923 3UTR 100% 4.050 2.835 N SLC9A3R2 n/a
6 TRCN0000043707 GATGAACACTTCAAGCGGCTT pLKO.1 1438 CDS 100% 2.160 1.512 N SLC9A3R2 n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 6 5UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 6 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017023894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02147 pDONR223 100% 68.2% 52% None (many diffs) n/a
2 ccsbBroad304_02147 pLX_304 0% 68.2% 52% V5 (many diffs) n/a
3 TRCN0000475544 AAACATCCATCCACGTGAAGCTGT pLX_317 13.9% 68.2% 52% V5 (many diffs) n/a
4 ccsbBroadEn_07400 pDONR223 100% 68.1% 52% None (many diffs) n/a
5 ccsbBroad304_07400 pLX_304 0% 68.1% 52% V5 (many diffs) n/a
6 TRCN0000470457 AGCGTTCCGTTCCTCATGTGAGCA pLX_317 44% 68.1% 52% V5 (many diffs) n/a
Download CSV