Transcript: Human XM_017020636.1

PREDICTED: Homo sapiens transmembrane and coiled-coil domains 3 (TMCO3), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMCO3 (55002)
Length:
1869
CDS:
362..1648

Additional Resources:

NCBI RefSeq record:
XM_017020636.1
NBCI Gene record:
TMCO3 (55002)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000145276 GATTGCCTACAATGTTTGGTT pLKO.1 1236 CDS 100% 3.000 4.200 N TMCO3 n/a
2 TRCN0000144829 GTGGAGACATTAGGAGAATTT pLKO.1 1319 CDS 100% 13.200 9.240 N TMCO3 n/a
3 TRCN0000140852 CTTGGGTCTTAGCATGCTGAT pLKO.1 1078 CDS 100% 4.050 2.835 N TMCO3 n/a
4 TRCN0000143549 GAAGAGGCCAATTCTAAGCAA pLKO.1 1028 CDS 100% 3.000 2.100 N TMCO3 n/a
5 TRCN0000140136 GATGTAAGAAAGGCAGCGGAT pLKO.1 917 CDS 100% 2.160 1.512 N TMCO3 n/a
6 TRCN0000144909 GCAGTTCTGAACAAACTGAAA pLKO.1 557 CDS 100% 0.495 0.297 N TMCO3 n/a
7 TRCN0000200883 GACGACAATAAATCAGTCAAA pLKO.1 971 CDS 100% 4.950 6.930 N Tmco3 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1847 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12131 pDONR223 100% 96.3% 95.5% None (many diffs) n/a
2 ccsbBroad304_12131 pLX_304 0% 96.3% 95.5% V5 (many diffs) n/a
3 TRCN0000480630 ACAGAGATGTCACGTATCACGGAA pLX_317 29.4% 96.3% 95.5% V5 (many diffs) n/a
4 ccsbBroadEn_08447 pDONR223 100% 61.7% 60.6% None (many diffs) n/a
5 ccsbBroad304_08447 pLX_304 0% 61.7% 60.6% V5 (many diffs) n/a
6 TRCN0000491571 CTGATCTCAAAAAGCTGTAGGTAG pLX_317 12.8% 61.7% 60.6% V5 (many diffs) n/a
Download CSV