Transcript: Human XM_017029564.1

PREDICTED: Homo sapiens NAD(P) dependent steroid dehydrogenase-like (NSDHL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NSDHL (50814)
Length:
1495
CDS:
79..1248

Additional Resources:

NCBI RefSeq record:
XM_017029564.1
NBCI Gene record:
NSDHL (50814)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017029564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000335872 CCAAGTCGCACGGACTCATTT pLKO_005 159 CDS 100% 13.200 18.480 N NSDHL n/a
2 TRCN0000335869 TCCTGACAGGCCTCAATTATG pLKO_005 971 CDS 100% 13.200 18.480 N NSDHL n/a
3 TRCN0000026431 GCGTCGATATCAAGAATGGAA pLKO.1 581 CDS 100% 3.000 4.200 N NSDHL n/a
4 TRCN0000335870 CCCTGTGGATTGATGAAATAA pLKO_005 1302 3UTR 100% 15.000 10.500 N NSDHL n/a
5 TRCN0000335871 AGGATATGCTGTCAATGTATT pLKO_005 306 CDS 100% 13.200 9.240 N NSDHL n/a
6 TRCN0000026483 GCACCAAGAATGTCATTGAAA pLKO.1 497 CDS 100% 5.625 3.938 N NSDHL n/a
7 TRCN0000026475 CCCACCATCCAGTAACAACAA pLKO.1 447 CDS 100% 4.950 3.465 N NSDHL n/a
8 TRCN0000026496 CGGCAAGATGAAGTTCGTGAT pLKO.1 789 CDS 100% 4.050 2.835 N NSDHL n/a
9 TRCN0000335951 CGGCAAGATGAAGTTCGTGAT pLKO_005 789 CDS 100% 4.050 2.835 N NSDHL n/a
10 TRCN0000026461 GCTGGGCTCTCTCGACACGTT pLKO.1 1261 3UTR 100% 0.000 0.000 N NSDHL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017029564.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08183 pDONR223 100% 95.8% 95.8% None 1_48del;180T>G n/a
2 ccsbBroad304_08183 pLX_304 0% 95.8% 95.8% V5 1_48del;180T>G n/a
3 TRCN0000471342 ATTCTCAGAACAATTGCCATCCCA pLX_317 42.7% 95.8% 95.8% V5 1_48del;180T>G n/a
Download CSV