Transcript: Human XM_005272422.3

PREDICTED: Homo sapiens WASP homolog associated with actin, golgi membranes and microtubules (WHAMM), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
WHAMM (123720)
Length:
3211
CDS:
153..1892

Additional Resources:

NCBI RefSeq record:
XM_005272422.3
NBCI Gene record:
WHAMM (123720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005272422.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254062 TCCCACGCGGTGTCAGTAATT pLKO_005 1200 CDS 100% 13.200 18.480 N WHAMM n/a
2 TRCN0000254065 CCCTATCGGAAGCTGGTAATG pLKO_005 1252 CDS 100% 10.800 15.120 N WHAMM n/a
3 TRCN0000254063 ACTGGTAAGCAGTACTATTAG pLKO_005 2885 3UTR 100% 13.200 9.240 N WHAMM n/a
4 TRCN0000254064 GGATGGTTAGGCTCAAGTTTG pLKO_005 1883 CDS 100% 10.800 7.560 N WHAMM n/a
5 TRCN0000254066 TGTTCCAGTTGGTGATCAAAC pLKO_005 1325 CDS 100% 10.800 7.560 N WHAMM n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2352 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2352 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005272422.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10614 pDONR223 100% 20.7% 18.9% None (many diffs) n/a
2 ccsbBroad304_10614 pLX_304 0% 20.7% 18.9% V5 (many diffs) n/a
3 TRCN0000480110 GCTCGCCCGCTCGGCTTAGGCTCA pLX_317 59.8% 20.7% 18.9% V5 (many diffs) n/a
Download CSV