Transcript: Mouse XM_011247552.2

PREDICTED: Mus musculus ring finger protein, LIM domain interacting (Rlim), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rlim (19820)
Length:
7531
CDS:
403..2205

Additional Resources:

NCBI RefSeq record:
XM_011247552.2
NBCI Gene record:
Rlim (19820)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011247552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095743 GAGTACTATCAGGATTCCTAT pLKO.1 1518 CDS 100% 4.950 6.930 N Rlim n/a
2 TRCN0000326883 GAGTACTATCAGGATTCCTAT pLKO_005 1518 CDS 100% 4.950 6.930 N Rlim n/a
3 TRCN0000095740 GCAGAATCTTAAATACTGGAT pLKO.1 1541 CDS 100% 2.640 2.112 N Rlim n/a
4 TRCN0000326881 GCAGAATCTTAAATACTGGAT pLKO_005 1541 CDS 100% 2.640 2.112 N Rlim n/a
5 TRCN0000417217 CCCAGTCACATTTGATGAAAG pLKO_005 1878 CDS 100% 10.800 7.560 N RLIM n/a
6 TRCN0000095739 GCCCTGAAGAATGGACCATAT pLKO.1 3235 3UTR 100% 10.800 7.560 N Rlim n/a
7 TRCN0000326879 GCCCTGAAGAATGGACCATAT pLKO_005 3235 3UTR 100% 10.800 7.560 N Rlim n/a
8 TRCN0000095742 CCTCCAACCATAGTTCTTGAT pLKO.1 1327 CDS 100% 4.950 3.465 N Rlim n/a
9 TRCN0000354224 CCTCCAACCATAGTTCTTGAT pLKO_005 1327 CDS 100% 4.950 3.465 N Rlim n/a
10 TRCN0000095741 CGAGAGTAGCTCAGAGATGTT pLKO.1 1797 CDS 100% 4.950 3.465 N Rlim n/a
11 TRCN0000326814 CGAGAGTAGCTCAGAGATGTT pLKO_005 1797 CDS 100% 4.950 3.465 N Rlim n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011247552.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03224 pDONR223 100% 84% 85.7% None (many diffs) n/a
2 ccsbBroad304_03224 pLX_304 0% 84% 85.7% V5 (many diffs) n/a
3 TRCN0000467295 ACCATCATGATTGCCCTGGGATGG pLX_317 17.1% 84% 85.7% V5 (many diffs) n/a
Download CSV