Transcript: Mouse XR_001780404.1

PREDICTED: Mus musculus methyl-CpG binding domain protein 5 (Mbd5), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbd5 (109241)
Length:
9619
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780404.1
NBCI Gene record:
Mbd5 (109241)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000253596 AGTGAATCAGAACCCTATTAT pLKO_005 2379 3UTR 100% 15.000 21.000 N Mbd5 n/a
2 TRCN0000253597 GTATGAACAAAGCGGTAAATG pLKO_005 6601 3UTR 100% 13.200 18.480 N Mbd5 n/a
3 TRCN0000253599 GGATATCCCTAACCCATTAAT pLKO_005 2832 3UTR 100% 15.000 12.000 N Mbd5 n/a
4 TRCN0000295991 GGATATCCCTAACCCATTAAT pLKO_005 2832 3UTR 100% 15.000 12.000 N MBD5 n/a
5 TRCN0000253600 CAGGTCTGCTTGGTGATATAT pLKO_005 4814 3UTR 100% 15.000 10.500 N Mbd5 n/a
6 TRCN0000253598 CCTAAACCAGAATCTATTAAA pLKO_005 4089 3UTR 100% 15.000 10.500 N Mbd5 n/a
7 TRCN0000038769 CGAGCAATGTTCCACCACAAA pLKO.1 2248 3UTR 100% 4.950 3.465 N MBD5 n/a
8 TRCN0000038772 GCCAAATCAAAGGACTGACTT pLKO.1 6149 3UTR 100% 4.950 3.465 N MBD5 n/a
9 TRCN0000038771 CCCAAAGATCACGCTCATCTT pLKO.1 2645 3UTR 100% 0.495 0.347 N MBD5 n/a
10 TRCN0000298783 CCCAAAGATCACGCTCATCTT pLKO_005 2645 3UTR 100% 0.495 0.347 N MBD5 n/a
11 TRCN0000038773 GCTTGTCTGTTTCAGAACTTT pLKO.1 5014 3UTR 100% 5.625 3.938 N MBD5 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 8570 3UTR 100% 4.950 2.475 Y KAAG1 n/a
13 TRCN0000177808 CCTGGAACTTGCTATGTAGAT pLKO.1 8671 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
14 TRCN0000286002 CCTGGAACTTGCTATGTAGAT pLKO_005 8671 3UTR 100% 4.950 2.475 Y 2310022A10Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780404.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12272 pDONR223 100% 6.7% None (many diffs) n/a
2 ccsbBroad304_12272 pLX_304 0% 6.7% V5 (many diffs) n/a
3 TRCN0000473566 CCTTGGAACCGATTTTTTGTAAAG pLX_317 67% 6.7% V5 (many diffs) n/a
Download CSV