Transcript: Mouse XM_006502037.3

PREDICTED: Mus musculus hemochromatosis type 2 (juvenile) (Hfe2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hfe2 (69585)
Length:
2059
CDS:
273..1535

Additional Resources:

NCBI RefSeq record:
XM_006502037.3
NBCI Gene record:
Hfe2 (69585)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425506 CCGAATCTTCTTGACGGATTT pLKO_005 1403 CDS 100% 10.800 15.120 N Hfe2 n/a
2 TRCN0000127151 CATTGGAACAACTATCATCAT pLKO.1 1091 CDS 100% 4.950 6.930 N Hfe2 n/a
3 TRCN0000423363 GAGATTGTGAGAGTGCTAATG pLKO_005 1819 3UTR 100% 10.800 8.640 N Hfe2 n/a
4 TRCN0000438098 AGCTTGGCCCTTGCTAGATAA pLKO_005 818 CDS 100% 13.200 9.240 N Hfe2 n/a
5 TRCN0000427568 GACTGGTTTGGAAACGATTTG pLKO_005 1549 3UTR 100% 10.800 7.560 N Hfe2 n/a
6 TRCN0000127153 GTGGCTTTGCTTCAGTAAGTA pLKO.1 1514 CDS 100% 5.625 3.938 N Hfe2 n/a
7 TRCN0000127149 CCACTCTCCATACACCTGATA pLKO.1 1781 3UTR 100% 4.950 3.465 N Hfe2 n/a
8 TRCN0000127152 GCTCGAGTTTGTCCATTCAAA pLKO.1 1030 CDS 100% 0.000 0.000 N Hfe2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05017 pDONR223 100% 40.8% 42.1% None (many diffs) n/a
2 ccsbBroad304_05017 pLX_304 0% 40.8% 42.1% V5 (many diffs) n/a
3 TRCN0000475478 TGAGTCTCCTTCTGAGCTTATATT pLX_317 52.7% 40.8% 42.1% V5 (many diffs) n/a
Download CSV