Transcript: Mouse XM_006538292.3

PREDICTED: Mus musculus RIKEN cDNA 3110043O21 gene (3110043O21Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
3110043O21Rik (73205)
Length:
3307
CDS:
267..1712

Additional Resources:

NCBI RefSeq record:
XM_006538292.3
NBCI Gene record:
3110043O21Rik (73205)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006538292.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267379 GGGCGATCTTAACATAATAAT pLKO_005 1592 CDS 100% 15.000 21.000 N 3110043O21Rik n/a
2 TRCN0000267375 AGCACTTATGGACTATCAATT pLKO_005 588 CDS 100% 13.200 9.240 N 3110043O21Rik n/a
3 TRCN0000267376 TCAGAGTACATTCGCTGATAA pLKO_005 2610 3UTR 100% 13.200 9.240 N 3110043O21Rik n/a
4 TRCN0000267378 TCCTAGAGTAAGGCATATTTG pLKO_005 380 CDS 100% 13.200 9.240 N 3110043O21Rik n/a
5 TRCN0000149351 GCCAAGACAGAGATTGCTTTA pLKO.1 303 CDS 100% 10.800 7.560 N C9orf72 n/a
6 TRCN0000267377 CCTACCCTTCCGGCAAGTTAT pLKO_005 1142 CDS 100% 13.200 7.920 N 3110043O21Rik n/a
7 TRCN0000127519 CAATGCCATCAGCTCACACTT pLKO.1 929 CDS 100% 4.950 3.465 N C9orf72 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006538292.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05210 pDONR223 100% 90.4% 98.1% None (many diffs) n/a
2 ccsbBroad304_05210 pLX_304 0% 90.4% 98.1% V5 (many diffs) n/a
3 TRCN0000471027 CTCATTGCAGACATACATACAACT pLX_317 30% 90.4% 98.1% V5 (many diffs) n/a
Download CSV