Transcript: Mouse XM_006540569.3

PREDICTED: Mus musculus adaptor-related protein complex 2, alpha 1 subunit (Ap2a1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ap2a1 (11771)
Length:
3543
CDS:
473..3178

Additional Resources:

NCBI RefSeq record:
XM_006540569.3
NBCI Gene record:
Ap2a1 (11771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006540569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000277542 CTGGACTTGCCCTGGTATATG pLKO_005 3182 3UTR 100% 13.200 18.480 N Ap2a1 n/a
2 TRCN0000380923 GCCGCATGTATCTCTTCTATG pLKO_005 2565 CDS 100% 10.800 15.120 N AP2A1 n/a
3 TRCN0000277476 GGCCCAAATGTACCGTCTAAC pLKO_005 3094 CDS 100% 10.800 8.640 N Ap2a1 n/a
4 TRCN0000179650 GAACCTGCTAAGCTCTAACAA pLKO.1 484 CDS 100% 5.625 3.938 N Ap2a1 n/a
5 TRCN0000285964 GAACCTGCTAAGCTCTAACAA pLKO_005 484 CDS 100% 5.625 3.938 N Ap2a1 n/a
6 TRCN0000179832 CAAGAAGAATCCGGATGACTT pLKO.1 889 CDS 100% 4.950 3.465 N Ap2a1 n/a
7 TRCN0000179889 CCAGGACTACACTTACTACTT pLKO.1 976 CDS 100% 4.950 3.465 N Ap2a1 n/a
8 TRCN0000277474 CCAGGACTACACTTACTACTT pLKO_005 976 CDS 100% 4.950 3.465 N Ap2a1 n/a
9 TRCN0000179526 GCTATCCTCTTTGAGACCATT pLKO.1 1166 CDS 100% 4.950 3.465 N Ap2a1 n/a
10 TRCN0000277543 GCTATCCTCTTTGAGACCATT pLKO_005 1166 CDS 100% 4.950 3.465 N Ap2a1 n/a
11 TRCN0000380035 GCCTTGGATGGCTACAGTAAG pLKO_005 389 5UTR 100% 10.800 7.560 N AP2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006540569.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14534 pDONR223 58.4% 76.1% 49.4% None (many diffs) n/a
2 ccsbBroad304_14534 pLX_304 0% 76.1% 49.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV