Transcript: Mouse XM_017322325.1

PREDICTED: Mus musculus BR serine/threonine kinase 1 (Brsk1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Brsk1 (381979)
Length:
3125
CDS:
332..2752

Additional Resources:

NCBI RefSeq record:
XM_017322325.1
NBCI Gene record:
Brsk1 (381979)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017322325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000226450 ACAAATATTCCTCGTGCTAAA pLKO_005 2149 CDS 100% 10.800 15.120 N BRSK1 n/a
2 TRCN0000195522 CGACGTCTACGAGAACAAGAA pLKO.1 622 CDS 100% 4.950 6.930 N BRSK1 n/a
3 TRCN0000024399 CGTCGGTTCAAACGTGTGGTA pLKO.1 2429 CDS 100% 2.640 3.696 N Brsk1 n/a
4 TRCN0000024400 CCACCTCGTAAGCGTGTGGAT pLKO.1 1460 CDS 100% 0.880 1.232 N Brsk1 n/a
5 TRCN0000024402 GCCGCAGAGTAGCCATGCGTA pLKO.1 1233 CDS 100% 0.000 0.000 N Brsk1 n/a
6 TRCN0000194778 CAAATATTCCTCGTGCTAAAG pLKO.1 2150 CDS 100% 10.800 8.640 N BRSK1 n/a
7 TRCN0000199927 GCTTAGCAGATCCGGACAGGG pLKO.1 2894 3UTR 100% 0.000 0.000 N BRSK1 n/a
8 TRCN0000361047 CCTACTGTGAATCTGTATATA pLKO_005 2672 CDS 100% 15.000 10.500 N Brsk1 n/a
9 TRCN0000218088 ACGTCTACGAGAACAAGAAAT pLKO_005 624 CDS 100% 13.200 9.240 N BRSK1 n/a
10 TRCN0000360985 ACGTCTACGAGAACAAGAAAT pLKO_005 624 CDS 100% 13.200 9.240 N Brsk1 n/a
11 TRCN0000355545 AGGCTCAGTCTGGAGCAAATT pLKO_005 1148 CDS 100% 13.200 9.240 N BRSK1 n/a
12 TRCN0000078904 CGTCTACGAGAACAAGAAATA pLKO.1 625 CDS 100% 13.200 9.240 N LOC436019 n/a
13 TRCN0000368711 GCTGTGGAGTCATCCTATTTG pLKO_005 978 CDS 100% 13.200 9.240 N Brsk1 n/a
14 TRCN0000024403 CCTTGGACAAAGAAGAACAAA pLKO.1 2133 CDS 100% 5.625 3.938 N Brsk1 n/a
15 TRCN0000078903 GCCATCCTGAAGCTCATTGAA pLKO.1 578 CDS 100% 5.625 3.938 N LOC436019 n/a
16 TRCN0000024401 CTTCCACATGCCTCACTTCAT pLKO.1 1072 CDS 100% 4.950 3.465 N Brsk1 n/a
17 TRCN0000078907 CAAGATCGTGAACAGGGAGAA pLKO.1 517 CDS 100% 4.050 2.835 N LOC436019 n/a
18 TRCN0000078905 CCACTGCATCACGGGTCAGAA pLKO.1 487 CDS 100% 1.650 1.155 N LOC436019 n/a
19 TRCN0000078906 GCTGTCGGAATCGGTGCTGAT pLKO.1 538 CDS 100% 1.350 0.945 N LOC436019 n/a
20 TRCN0000361048 TCGCCATCCTGAAGCTCATTG pLKO_005 576 CDS 100% 10.800 6.480 N Brsk1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017322325.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15197 pDONR223 0% 53% 57.9% None (many diffs) n/a
2 ccsbBroad304_15197 pLX_304 0% 53% 57.9% V5 (many diffs) n/a
3 TRCN0000469730 TATCATGTCAACCCTCGCGGGCAG pLX_317 14.2% 53% 57.9% V5 (many diffs) n/a
Download CSV