Transcript: Mouse XR_001778006.1

PREDICTED: Mus musculus autophagy related 16-like 2 (S. cerevisiae) (Atg16l2), transcript variant X14, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg16l2 (73683)
Length:
6236
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778006.1
NBCI Gene record:
Atg16l2 (73683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000251623 GGAGCTAGTGCCGGCTTATAA pLKO_005 347 3UTR 100% 15.000 21.000 N Atg16l2 n/a
2 TRCN0000251622 GCTGAGCGCAATCTACGTAAT pLKO_005 858 3UTR 100% 10.800 15.120 N Atg16l2 n/a
3 TRCN0000265220 CAAAGTGACTGCTGCCAAATT pLKO_005 1691 3UTR 100% 13.200 10.560 N Atg16l2 n/a
4 TRCN0000251621 GACAACACACTCAAGGTTATC pLKO_005 2153 3UTR 100% 10.800 7.560 N Atg16l2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778006.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09276 pDONR223 100% 25.4% None (many diffs) n/a
2 ccsbBroad304_09276 pLX_304 0% 25.4% V5 (many diffs) n/a
3 TRCN0000477269 GCTAGGGCAGTCTCGTTTCAAATC pLX_317 11.5% 25.4% V5 (many diffs) n/a
Download CSV