Construct: ORF TRCN0000477269
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008034.1_s317c1
- Derived from:
- ccsbBroadEn_09276
- DNA Barcode:
- GCTAGGGCAGTCTCGTTTCAAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATG16L2 (89849)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000477269
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | NM_033388.2 | 99.9% | 99.8% | 733G>T |
2 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_005274376.5 | 96.8% | 95.9% | (many diffs) |
3 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_006718732.2 | 96.5% | 96.2% | 733G>T;824_825ins63 |
4 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_011545332.1 | 93.8% | 93.8% | 710_711ins114 |
5 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | NM_001318766.2 | 82.8% | 82.7% | 0_1ins318;415G>T |
6 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_011545333.1 | 82.8% | 82.7% | 0_1ins318;415G>T |
7 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_011545334.1 | 82.8% | 82.7% | 0_1ins318;415G>T |
8 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XR_950094.1 | 81.6% | (many diffs) | |
9 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_006718733.3 | 54.8% | 53.4% | 733G>T;995_996ins47;1020_1021ins790 |
10 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XM_006718734.2 | 52.8% | 43.3% | (many diffs) |
11 | human | 89849 | ATG16L2 | autophagy related 16 like 2 | XR_001748024.2 | 39.1% | (many diffs) | |
12 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | NM_001111111.1 | 84.5% | 82.2% | (many diffs) |
13 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XM_006508226.3 | 78.5% | 76% | (many diffs) |
14 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XM_006508227.3 | 77.6% | 75.5% | (many diffs) |
15 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XM_011241916.2 | 76.7% | 71.9% | (many diffs) |
16 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XR_378274.3 | 67.4% | (many diffs) | |
17 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XM_006508228.1 | 64.7% | 61.5% | (many diffs) |
18 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XM_006508230.1 | 64.7% | 61.5% | (many diffs) |
19 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XM_011241918.1 | 64.7% | 61.5% | (many diffs) |
20 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XR_001778004.1 | 63.2% | (many diffs) | |
21 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XR_378276.3 | 59% | (many diffs) | |
22 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XR_001778005.1 | 54.9% | (many diffs) | |
23 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XR_001778007.1 | 43.8% | (many diffs) | |
24 | mouse | 73683 | Atg16l2 | autophagy related 16-like 2... | XR_001778006.1 | 25.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1926
- ORF length:
- 1857
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcggggccg ggcgtccccg gtgcccccgc agcgcgctgg aaacgccaca 121 tcgtgcggca gctgcggctt cgggaccgta cgcaaaaggc gcttttcctg gagctggtgc 181 cggcctataa ccatctctta gagaaggctg agctgctgga caagttctca aagaagctgc 241 agccggagcc aaacagtgtc actcccacca cccaccaggg cccctgggag gagtcagagc 301 ttgactcaga ccaagtccca tcactggtcg cactgagggt gaagtggcag gaggaggagg 361 aggggctccg gctggtctgt ggtgagatgg cctaccaggt ggtggagaag ggcgcggccc 421 tgggcacgct ggagtcggag ctgcagcaga ggcaaagcag gctggcagcc ctggaggccc 481 gcgtggcgca gctgcgagag gcgcgggcgc agcaggccca gcaggtggag gagtggcggg 541 cgcagaatgc ggtgcagcgg gcagcctacg aggcgctgcg cgcgcacgtc gggctccggg 601 aggcggcact gcgcaggctc caggaagagg cgcgcgacct gctggagagg ctcgtgcagc 661 gcaaggcgcg cgccgcggcc gagcgcaacc tgcgcaacga gcgccgggag cgggccaagc 721 aggcgcgggt gtcccaggag ctgaagaagg ctgccaagcg gaccgtgagc atcagcgagg 781 gcccggacac cctaggcgat tggatgaggg agagaaggga gactctggct ctggcccctg 841 agccagagcc cctggagaag gaagcttgtg agaagtggaa gaggcccttc aggtctgcct 901 cagccacctc cctgacgctg tcccactgtg tggatgtggt gaaggggctt ctggatttta 961 agaagaggag aggtcactca attgggggag cccctgagca gcgataccag atcatccctg 1021 tgtgtgtggc tgcccgactt cctacccggg ctcaggatgt gctggatgcc cacctctctg 1081 aggtcaatgc tgttcgtttt ggccccaaca gcagcctcct ggccactgga ggggctgacc 1141 gcctgatcca cctctggaat gttgtgggaa gtcgcctgga ggccaaccag accctggagg 1201 gagctggtgg cagcatcacc agtgtggact ttgacccctc gggctaccag gttttagcag 1261 caacttacaa ccaggctgcc cagctctgga aggtggggga ggcacagtcc aaggagacac 1321 tgtctggaca caaggataag gtgacagctg ccaaattcaa gctaacgagg caccaggcag 1381 tgactgggag ccgcgaccgg acagtgaagg agtgggacct cggccgtgcc tattgctcca 1441 ggaccatcaa tgtcctttcc tactgtaatg acgtggtgtg tggggaccat atcatcatta 1501 gtggccacaa tgaccagaag atccggttct gggacagcag ggggccccac tgcacccagg 1561 tcatccctgt gcagggccgg gtcacctccc tgagcctcag ccacgaccaa ctgcacctgc 1621 tcagctgttc ccgagacaac acactcaagg tcatcgacct gcgtgtcagc aacatccgcc 1681 aggtgttcag ggccgatggc ttcaagtgtg gttctgacTG GACCAAAGCT GTGTTCAGCC 1741 CGGACAGAAG CTATGCACTG GCAGGCTCCT GTGATGGGGC CCTTTACATC TGGGATGTGG 1801 ACACCGGGAA ACTGGAGAGC AGACTACAGG GACCCCATTG CGCTGCCGTC AACGCCGTGG 1861 CCTGGTGCTA CTCCGGGAGC CACATGGTGA GCGTGGACCA GGGCAGGAAG GTTGTGCTCT 1921 GGCAGTTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1981 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 2041 CTTGGCTTTA TATATCTTGT GGAAAGGACG AGCTAGGGCA GTCTCGTTTC AAATCACGCG 2101 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt