Transcript: Mouse XM_017315376.1

PREDICTED: Mus musculus complexin 2 (Cplx2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cplx2 (12890)
Length:
1285
CDS:
610..1014

Additional Resources:

NCBI RefSeq record:
XM_017315376.1
NBCI Gene record:
Cplx2 (12890)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017315376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115102 CCGAGACAAGTATGGGCTGAA pLKO.1 807 CDS 100% 4.050 5.670 N Cplx2 n/a
2 TRCN0000115103 CTGGACACAGTGCTCAAATAT pLKO.1 958 CDS 100% 15.000 10.500 N Cplx2 n/a
3 TRCN0000381986 AGCAGATCCGAGACAAGTATG pLKO_005 800 CDS 100% 10.800 7.560 N Cplx2 n/a
4 TRCN0000380606 CAAGTATGGGCTGAAGAAGAA pLKO_005 813 CDS 100% 4.950 3.465 N Cplx2 n/a
5 TRCN0000115104 GCAGCAGATCCGAGACAAGTA pLKO.1 798 CDS 100% 4.950 3.465 N Cplx2 n/a
6 TRCN0000115105 GAAGGACCCAGACGCACAGAA pLKO.1 684 CDS 100% 1.650 1.155 N Cplx2 n/a
7 TRCN0000382211 ACGCACAGAAGAAGGAGGAGG pLKO_005 695 CDS 100% 0.720 0.504 N Cplx2 n/a
8 TRCN0000115101 CCAGGGTTTCTAGTCCTGTTT pLKO.1 1206 3UTR 100% 4.950 2.970 N Cplx2 n/a
9 TRCN0000180407 GCTGCAGGACATGTTCAAGAA pLKO.1 990 CDS 100% 4.950 2.970 N CPLX2 n/a
10 TRCN0000381054 GCCGCTGCAGGACATGTTCAA pLKO_005 987 CDS 100% 1.650 0.990 N Cplx2 n/a
11 TRCN0000179646 GCAGGACATGTTCAAGAAGTA pLKO.1 993 CDS 100% 4.950 2.475 Y CPLX2 n/a
12 TRCN0000381987 AGAGAAAGAGGCAGAGGAGAA pLKO_005 837 CDS 100% 4.050 2.025 Y Cplx2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017315376.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02535 pDONR223 100% 92.7% 100% None (many diffs) n/a
2 ccsbBroad304_02535 pLX_304 0% 92.7% 100% V5 (many diffs) n/a
3 TRCN0000477153 GGACGACTTTAAAGACCGGTCGCG pLX_317 89.8% 92.7% 100% V5 (many diffs) n/a
Download CSV