Transcript: Mouse XM_006513327.3

PREDICTED: Mus musculus protein phosphatase 1, regulatory (inhibitor) subunit 12A (Ppp1r12a), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppp1r12a (17931)
Length:
6212
CDS:
570..3566

Additional Resources:

NCBI RefSeq record:
XM_006513327.3
NBCI Gene record:
Ppp1r12a (17931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006513327.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240625 TATGGAACTAACGGATCTAAA pLKO_005 3428 CDS 100% 13.200 18.480 N Ppp1r12a n/a
2 TRCN0000240624 TCTCGTCCTCTTTGGATAATA pLKO_005 1996 CDS 100% 15.000 12.000 N Ppp1r12a n/a
3 TRCN0000240627 CAAACAGTCTTGTAGGTATAA pLKO_005 2965 CDS 100% 13.200 10.560 N Ppp1r12a n/a
4 TRCN0000240623 GAGCCTTGATCAGAGTTATAA pLKO_005 3635 3UTR 100% 15.000 10.500 N Ppp1r12a n/a
5 TRCN0000240626 TGAGACTTACACACGTTATAG pLKO_005 2852 CDS 100% 13.200 9.240 N Ppp1r12a n/a
6 TRCN0000002445 GCCTTTGATGTAGCAGATGAA pLKO.1 1371 CDS 100% 4.950 3.465 N PPP1R12A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006513327.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06613 pDONR223 100% 85.3% 89.4% None (many diffs) n/a
2 ccsbBroad304_06613 pLX_304 0% 85.3% 89.4% V5 (many diffs) n/a
3 TRCN0000472541 ATCGCGCAGATCGTGGAATATTAG pLX_317 15.7% 85.3% 89.4% V5 (many diffs) n/a
Download CSV