Transcript: Mouse XM_006526612.2

PREDICTED: Mus musculus beta-transducin repeat containing protein (Btrc), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Btrc (12234)
Length:
4395
CDS:
96..1727

Additional Resources:

NCBI RefSeq record:
XM_006526612.2
NBCI Gene record:
Btrc (12234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006526612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012804 CGTCAGAGTGTGGGATGTAAA pLKO.1 1001 CDS 100% 13.200 18.480 N Btrc n/a
2 TRCN0000432200 TGGTACGCTGCATTCGATTTG pLKO_005 1432 CDS 100% 10.800 15.120 N Btrc n/a
3 TRCN0000012806 GCGACATAGTTTACAGAGAAT pLKO.1 776 CDS 100% 4.950 6.930 N Btrc n/a
4 TRCN0000012805 CCGCCTCCAGTTTGATGAATT pLKO.1 1586 CDS 100% 0.000 0.000 N Btrc n/a
5 TRCN0000418979 GAATTTGTAGAACACCTTATA pLKO_005 360 CDS 100% 13.200 10.560 N Btrc n/a
6 TRCN0000429686 GCACATCAACTCCTACCTAAA pLKO_005 407 CDS 100% 10.800 8.640 N Btrc n/a
7 TRCN0000414576 TGAGACAATAGAGTCCAATTG pLKO_005 746 CDS 100% 10.800 8.640 N Btrc n/a
8 TRCN0000012807 GCCAGGCTTTGCATAAACCAA pLKO.1 159 CDS 100% 3.000 1.800 N Btrc n/a
9 TRCN0000012803 GCCTCATAATTGCCCAGGATT pLKO.1 1742 3UTR 100% 4.950 6.930 N Btrc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006526612.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02053 pDONR223 100% 80.6% 88.4% None (many diffs) n/a
2 ccsbBroad304_02053 pLX_304 34.3% 80.6% 88.4% V5 (many diffs) n/a
3 TRCN0000469234 CAGCAAGAGATGAGACCATGAATA pLX_317 16% 80.6% 88.4% V5 (many diffs) n/a
Download CSV