Transcript: Mouse XM_017319625.1

PREDICTED: Mus musculus family with sequence similarity 19, member A3 (Fam19a3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam19a3 (329731)
Length:
4359
CDS:
524..1030

Additional Resources:

NCBI RefSeq record:
XM_017319625.1
NBCI Gene record:
Fam19a3 (329731)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017319625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000282955 ACATCCGCAGTCCTAGTGAAG pLKO_005 734 CDS 100% 4.050 5.670 N Fam19a3 n/a
2 TRCN0000264261 ACGGTAACTCTCGGAGGTCAT pLKO_005 1024 CDS 100% 4.050 5.670 N Fam19a3 n/a
3 TRCN0000374492 GGAATATCTTGTCAAGTTAAG pLKO_005 1271 3UTR 100% 10.800 8.640 N Fam19a3 n/a
4 TRCN0000374491 TGCAACCGGAACCGCATTGAG pLKO_005 791 CDS 100% 1.650 1.320 N Fam19a3 n/a
5 TRCN0000264263 AGGTAAATCAGCCATAGTTTA pLKO_005 2289 3UTR 100% 13.200 9.240 N Fam19a3 n/a
6 TRCN0000264262 AGCAGTGGACACAAGGTCAAA pLKO_005 989 CDS 100% 4.950 3.465 N Fam19a3 n/a
7 TRCN0000282956 GCAGAAGTGGTGGTGTCAGAT pLKO_005 907 CDS 100% 4.950 3.465 N Fam19a3 n/a
8 TRCN0000179122 CCAACATGATTCTTGGGAGAT pLKO.1 1856 3UTR 100% 4.050 2.835 N Fam19a3 n/a
9 TRCN0000184233 GCCATGCATTTAGTGGGTGAA pLKO.1 3170 3UTR 100% 4.050 2.835 N Fam19a3 n/a
10 TRCN0000374440 CTGCTGGGAGAGGAGTGTAAG pLKO_005 938 CDS 100% 3.600 2.520 N Fam19a3 n/a
11 TRCN0000179358 GCACTGGAAAGTAGAGATGAA pLKO.1 1554 3UTR 100% 4.950 2.970 N Fam19a3 n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1955 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017319625.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05381 pDONR223 100% 56.1% 39% None (many diffs) n/a
2 ccsbBroad304_05381 pLX_304 0% 56.1% 39% V5 (many diffs) n/a
3 TRCN0000476817 GGTAGAAAGCCTACACAACTAGCG pLX_317 65.8% 56.1% 39% V5 (many diffs) n/a
Download CSV