Transcript: Mouse XM_011238398.2

PREDICTED: Mus musculus junctophilin 1 (Jph1), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Jph1 (57339)
Length:
2606
CDS:
301..2283

Additional Resources:

NCBI RefSeq record:
XM_011238398.2
NBCI Gene record:
Jph1 (57339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011238398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176404 CACCAAAGGAATCTCCTCATT pLKO.1 1643 CDS 100% 4.950 3.465 N Jph1 n/a
2 TRCN0000193879 CGGCTACTATGTGAAACTGAA pLKO.1 1950 CDS 100% 4.950 3.465 N Jph1 n/a
3 TRCN0000193190 CCTTTGTCAATAAACCCTCTA pLKO.1 1826 CDS 100% 4.050 2.835 N Jph1 n/a
4 TRCN0000128330 GAACCAAAGTGGAAATAGCAA pLKO.1 1412 CDS 100% 3.000 2.100 N JPH1 n/a
5 TRCN0000173870 GAGGAACAAGTGACAGCCTTT pLKO.1 1810 CDS 100% 4.050 2.430 N Jph1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011238398.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08649 pDONR223 100% 89.6% 93% None (many diffs) n/a
2 ccsbBroad304_08649 pLX_304 0% 89.6% 93% V5 (many diffs) n/a
3 TRCN0000480162 CCTGGACACAATCTCTGCAAATTA pLX_317 18% 89.6% 93% V5 (many diffs) n/a
Download CSV