Transcript: Mouse XM_006500068.3

PREDICTED: Mus musculus N-acetylneuraminic acid phosphatase (Nanp), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nanp (67311)
Length:
1445
CDS:
157..879

Additional Resources:

NCBI RefSeq record:
XM_006500068.3
NBCI Gene record:
Nanp (67311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006500068.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196234 GCCATTGTTATTGGCGGAGAA pLKO.1 589 CDS 100% 4.050 5.670 N Nanp n/a
2 TRCN0000244535 TATCCGAAATCCAGGTATTAA pLKO_005 1057 3UTR 100% 15.000 12.000 N Nanp n/a
3 TRCN0000217352 GAAAGCTACGGTCTGGATAAA pLKO.1 741 CDS 100% 13.200 9.240 N Nanp n/a
4 TRCN0000244533 TCACCCATGCCTCACTATATG pLKO_005 790 CDS 100% 13.200 9.240 N Nanp n/a
5 TRCN0000244532 TCTCTTGCAAAGCATAGATTG pLKO_005 837 CDS 100% 10.800 7.560 N Nanp n/a
6 TRCN0000180597 GCTAGAATTACCTGCTCTCTT pLKO.1 822 CDS 100% 4.950 3.465 N Nanp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006500068.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04951 pDONR223 100% 77.5% 83.2% None (many diffs) n/a
2 ccsbBroad304_04951 pLX_304 0% 77.5% 83.2% V5 (many diffs) n/a
3 TRCN0000467080 TGCGAGCAGGACAGGTGCAATGTA pLX_317 50% 77.5% 83.2% V5 (many diffs) n/a
Download CSV