Transcript: Mouse XM_017321767.1

PREDICTED: Mus musculus SET domain containing 5 (Setd5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Setd5 (72895)
Length:
10604
CDS:
4242..8645

Additional Resources:

NCBI RefSeq record:
XM_017321767.1
NBCI Gene record:
Setd5 (72895)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098702 CGACAACAATTTGAGGTCAAT pLKO.1 5241 CDS 100% 4.950 6.930 N Setd5 n/a
2 TRCN0000098703 GCCATCAGACTTACGGACTAT pLKO.1 8462 CDS 100% 4.950 6.930 N Setd5 n/a
3 TRCN0000098704 CCCAAACACTACATTCGCTTT pLKO.1 6573 CDS 100% 4.050 5.670 N Setd5 n/a
4 TRCN0000253862 CAACCGTGCTGCATCTAAATA pLKO_005 6386 CDS 100% 15.000 10.500 N SETD5 n/a
5 TRCN0000253861 AGCGTGTATTCCACTCATAAT pLKO_005 4374 CDS 100% 13.200 9.240 N SETD5 n/a
6 TRCN0000098701 GCAGACTTACTGAGCCCATTA pLKO.1 6792 CDS 100% 10.800 7.560 N Setd5 n/a
7 TRCN0000098700 CCCTGCTGTTAAGGGTACATT pLKO.1 8865 3UTR 100% 5.625 3.938 N Setd5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12183 pDONR223 100% 57.1% 58.3% None (many diffs) n/a
2 ccsbBroad304_12183 pLX_304 0% 57.1% 58.3% V5 (many diffs) n/a
3 TRCN0000471018 TCACCTGCGTAGGGTTCCCTTGAC pLX_317 15.3% 57.1% 58.3% V5 (many diffs) n/a
Download CSV