Transcript: Mouse XM_011245933.2

PREDICTED: Mus musculus SUMO/sentrin specific peptidase 5 (Senp5), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Senp5 (320213)
Length:
4613
CDS:
843..3092

Additional Resources:

NCBI RefSeq record:
XM_011245933.2
NBCI Gene record:
Senp5 (320213)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011245933.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031032 GCATGGTTTAGATGACACATT pLKO.1 1841 CDS 100% 4.950 3.960 N Senp5 n/a
2 TRCN0000031030 CCATTCATCAATAGGGAAATA pLKO.1 2448 CDS 100% 13.200 9.240 N Senp5 n/a
3 TRCN0000031029 CCATGATTAGATTTCGGTATA pLKO.1 1540 CDS 100% 10.800 7.560 N Senp5 n/a
4 TRCN0000031031 CCAAAGGCTATAATGGAGTTA pLKO.1 2671 CDS 100% 4.950 3.465 N Senp5 n/a
5 TRCN0000031033 GCTTGTCAGCAAACACTGTTT pLKO.1 1264 CDS 100% 4.950 3.465 N Senp5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011245933.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09833 pDONR223 100% 86.7% 81.7% None (many diffs) n/a
2 ccsbBroad304_09833 pLX_304 0% 86.7% 81.7% V5 (many diffs) n/a
3 TRCN0000481654 GCAGAATGGCCTTGGGGTCATGGG pLX_317 23.6% 86.7% 81.7% V5 (many diffs) n/a
Download CSV