Transcript: Mouse XM_017321536.1

PREDICTED: Mus musculus histone deacetylase 11 (Hdac11), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hdac11 (232232)
Length:
768
CDS:
81..656

Additional Resources:

NCBI RefSeq record:
XM_017321536.1
NBCI Gene record:
Hdac11 (232232)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017321536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039226 CGTGTACTCACCACGTTACAA pLKO.1 230 CDS 100% 5.625 7.875 N Hdac11 n/a
2 TRCN0000039228 GCGCTATCTCAACGAGCTGAA pLKO.1 407 CDS 100% 4.050 5.670 N Hdac11 n/a
3 TRCN0000377110 AGACATCACACTGGCTATCAA pLKO_005 684 3UTR 100% 5.625 3.938 N Hdac11 n/a
4 TRCN0000039224 GCCACCATCATTGATCTCGAT pLKO.1 739 3UTR 100% 2.640 1.848 N Hdac11 n/a
5 TRCN0000195716 CAACTTCCTTGTGCAGAGGAA pLKO.1 482 CDS 100% 0.264 0.185 N HDAC11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017321536.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04146 pDONR223 100% 33.7% 33.5% None (many diffs) n/a
2 ccsbBroad304_04146 pLX_304 0% 33.7% 33.5% V5 (many diffs) n/a
3 TRCN0000473535 ACGGAAAGATTCGGCCTACCCCGC pLX_317 50.5% 33.7% 33.5% V5 (many diffs) n/a
Download CSV