Transcript: Human NM_001330193.1

Homo sapiens ribonucleotide reductase catalytic subunit M1 (RRM1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RRM1 (6240)
Length:
2554
CDS:
300..2012

Additional Resources:

NCBI RefSeq record:
NM_001330193.1
NBCI Gene record:
RRM1 (6240)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001330193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038968 CCAATCCAGTTCACTCTAAAT pLKO.1 1872 CDS 100% 13.200 10.560 N RRM1 n/a
2 TRCN0000300203 CCAATCCAGTTCACTCTAAAT pLKO_005 1872 CDS 100% 13.200 10.560 N RRM1 n/a
3 TRCN0000038966 GCTGAGCCTAACTATGGCAAA pLKO.1 1770 CDS 100% 4.050 2.835 N RRM1 n/a
4 TRCN0000300204 GCTGAGCCTAACTATGGCAAA pLKO_005 1770 CDS 100% 4.050 2.835 N RRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001330193.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06902 pDONR223 100% 71.8% 71.9% None (many diffs) n/a
2 ccsbBroad304_06902 pLX_304 0% 71.8% 71.9% V5 (many diffs) n/a
3 TRCN0000471540 CCGAACCCCTCTTCAGATAGATTT pLX_317 18.3% 71.8% 71.9% V5 (many diffs) n/a
Download CSV