Transcript: Human NM_001351310.1

Homo sapiens methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2 like (MTHFD2L), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-07-01
Taxon:
Homo sapiens (human)
Gene:
MTHFD2L (441024)
Length:
1719
CDS:
295..981

Additional Resources:

NCBI RefSeq record:
NM_001351310.1
NBCI Gene record:
MTHFD2L (441024)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351310.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265805 CCAAGAGTCAGCGGTATATTA pLKO_005 532 CDS 100% 15.000 21.000 N Mthfd2l n/a
2 TRCN0000051374 CCCAAGAGTCAGCGGTATATT pLKO.1 531 CDS 100% 15.000 21.000 N MTHFD2L n/a
3 TRCN0000051376 CCTCTGCTGTAGGTATTTGTA pLKO.1 437 CDS 100% 5.625 3.938 N MTHFD2L n/a
4 TRCN0000051373 CCTGAATGAATTTCCAGCAAA pLKO.1 1333 3UTR 100% 4.950 3.465 N MTHFD2L n/a
5 TRCN0000051377 GCGAACAATATGCAATGGAAT pLKO.1 585 CDS 100% 4.950 3.465 N MTHFD2L n/a
6 TRCN0000051375 GCCATACATATGTCAGGAATA pLKO.1 404 CDS 100% 0.000 0.000 N MTHFD2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351310.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13694 pDONR223 100% 61.3% 57.8% None (many diffs) n/a
2 ccsbBroad304_13694 pLX_304 0% 61.3% 57.8% V5 (many diffs) n/a
3 TRCN0000472987 ATCTCCGTTAAATGTTGACGAACG pLX_317 86.2% 61.3% 57.8% V5 (many diffs) n/a
Download CSV