Transcript: Human NM_001352977.1

Homo sapiens oxidoreductase NAD binding domain containing 1 (OXNAD1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-02-27
Taxon:
Homo sapiens (human)
Gene:
OXNAD1 (92106)
Length:
2953
CDS:
587..1525

Additional Resources:

NCBI RefSeq record:
NM_001352977.1
NBCI Gene record:
OXNAD1 (92106)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235140 TTTGCGCCACCTTACTCTAAC pLKO_005 682 CDS 100% 10.800 15.120 N OXNAD1 n/a
2 TRCN0000064449 CGCTTGCTTGTTGCTGATCAA pLKO.1 830 CDS 100% 4.950 6.930 N OXNAD1 n/a
3 TRCN0000064448 CCTTACTCTAACCAGCATAAT pLKO.1 691 CDS 100% 13.200 10.560 N OXNAD1 n/a
4 TRCN0000235139 TCTGTTGGAGCCATCCGTATT pLKO_005 629 CDS 100% 10.800 8.640 N OXNAD1 n/a
5 TRCN0000235142 AGGAGATAAGAGATCATATTT pLKO_005 1389 CDS 100% 15.000 10.500 N OXNAD1 n/a
6 TRCN0000235141 TGCAGGAGGAGTCGGAATTAA pLKO_005 1111 CDS 100% 15.000 10.500 N OXNAD1 n/a
7 TRCN0000064452 GCCAGTGGGTTGATTTCTTTA pLKO.1 870 CDS 100% 13.200 9.240 N OXNAD1 n/a
8 TRCN0000064451 AGAAGGAGATAAGAGATCATA pLKO.1 1386 CDS 100% 5.625 3.938 N OXNAD1 n/a
9 TRCN0000064450 GTCGGAATTAACCCTCTGCTT pLKO.1 1121 CDS 100% 2.640 1.848 N OXNAD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352977.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04569 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04569 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466557 GCGAAACTAATGCCATTTAAGAGA pLX_317 40.2% 100% 100% V5 n/a
Download CSV