Transcript: Human NM_001348430.2

Homo sapiens zinc finger protein 148 (ZNF148), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
ZNF148 (7707)
Length:
9494
CDS:
408..2792

Additional Resources:

NCBI RefSeq record:
NM_001348430.2
NBCI Gene record:
ZNF148 (7707)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230460 TGCACTTAATGTCCCTATAAG pLKO_005 725 CDS 100% 13.200 18.480 N ZNF148 n/a
2 TRCN0000012949 CCCACCTAAGTTAGTTCTCAA pLKO.1 1565 CDS 100% 4.950 6.930 N ZNF148 n/a
3 TRCN0000230461 GACATTGATCAGGTTGATAAT pLKO_005 1734 CDS 100% 13.200 10.560 N ZNF148 n/a
4 TRCN0000230462 AGTACCACGGCATCCATATTA pLKO_005 1941 CDS 100% 15.000 10.500 N ZNF148 n/a
5 TRCN0000230463 TACTTGAAGAAGCACTATAAT pLKO_005 6019 3UTR 100% 15.000 10.500 N ZNF148 n/a
6 TRCN0000218261 CCTGTGCATAGTAGTACTAAT pLKO_005 1776 CDS 100% 13.200 9.240 N ZNF148 n/a
7 TRCN0000095937 CCCTTGGTGAATGTAAATGAT pLKO.1 2715 CDS 100% 5.625 3.938 N Zfp148 n/a
8 TRCN0000095936 GCTGCCTTTAGAACGAACTAT pLKO.1 939 CDS 100% 5.625 3.938 N Zfp148 n/a
9 TRCN0000012952 GCAAAGTTTCAAAGTATGCTT pLKO.1 1666 CDS 100% 3.000 2.100 N ZNF148 n/a
10 TRCN0000012950 GCTTTCGATCAGGAATGAATT pLKO.1 2380 CDS 100% 0.000 0.000 N ZNF148 n/a
11 TRCN0000339379 TGAGACAACAGGATATGATAT pLKO_005 613 CDS 100% 13.200 7.920 N Zfp148 n/a
12 TRCN0000012948 GCAATGCGTAATAACAAGTTA pLKO.1 2889 3UTR 100% 5.625 3.375 N ZNF148 n/a
13 TRCN0000012951 GCATAGACGAAATGCAGTCTT pLKO.1 454 CDS 100% 4.950 2.970 N ZNF148 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348430.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11236 pDONR223 100% 15.2% 13.7% None (many diffs) n/a
2 ccsbBroad304_11236 pLX_304 0% 15.2% 13.7% V5 (many diffs) n/a
3 TRCN0000481491 GACTCCGTCAACCTGCTACCACTA pLX_317 100% 15.2% 13.7% V5 (many diffs) n/a
Download CSV