Transcript: Human NM_153490.3

Homo sapiens keratin 13 (KRT13), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KRT13 (3860)
Length:
1714
CDS:
63..1439

Additional Resources:

NCBI RefSeq record:
NM_153490.3
NBCI Gene record:
KRT13 (3860)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_153490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414223 TGATGTCCGTAGGCCTTAAAT pLKO_005 1421 CDS 100% 15.000 21.000 N KRT13 n/a
2 TRCN0000061908 GCTGGTGGCTTTGTTGACTTT pLKO.1 318 CDS 100% 4.950 3.465 N KRT13 n/a
3 TRCN0000061910 GTGGTGTCTCTACCTGTTCAA pLKO.1 142 CDS 100% 4.950 3.465 N KRT13 n/a
4 TRCN0000061909 CCCTACTACAAGACCATTGAA pLKO.1 522 CDS 100% 5.625 3.375 N KRT13 n/a
5 TRCN0000061912 GTCATCCTGGAGATTGACAAT pLKO.1 588 CDS 100% 4.950 2.970 N KRT13 n/a
6 TRCN0000061911 GCCTACATGAAGAAGAACCAT pLKO.1 771 CDS 100% 3.000 1.500 Y KRT13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_153490.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06506 pDONR223 100% 99.7% 99.5% None 114C>T;560C>T;892A>G n/a
2 ccsbBroad304_06506 pLX_304 0% 99.7% 99.5% V5 114C>T;560C>T;892A>G n/a
3 TRCN0000476017 TTGGATAGGGACAAACGGTCAACG pLX_317 28.8% 99.7% 99.5% V5 114C>T;560C>T;892A>G n/a
Download CSV