Transcript: Human NM_006555.4

Homo sapiens YKT6 v-SNARE homolog (YKT6), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
YKT6 (10652)
Length:
2767
CDS:
159..755

Additional Resources:

NCBI RefSeq record:
NM_006555.4
NBCI Gene record:
YKT6 (10652)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006555.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381655 AGGGTGGCGAATGTTCAAATT pLKO_005 910 3UTR 100% 13.200 18.480 N YKT6 n/a
2 TRCN0000380048 TGGGCAAATGAAACCATAAAC pLKO_005 986 3UTR 100% 13.200 18.480 N YKT6 n/a
3 TRCN0000382286 CGTCTACGTCCGGAATGATAG pLKO_005 359 CDS 100% 10.800 15.120 N YKT6 n/a
4 TRCN0000059764 CGCATACGATGTGTCTTCCTT pLKO.1 221 CDS 100% 3.000 4.200 N YKT6 n/a
5 TRCN0000299710 CGCATACGATGTGTCTTCCTT pLKO_005 221 CDS 100% 3.000 4.200 N YKT6 n/a
6 TRCN0000381074 CCTTCACGAGTCAACTGATTG pLKO_005 280 CDS 100% 10.800 8.640 N YKT6 n/a
7 TRCN0000059766 CGGAATGATAGTCTTGCAGGT pLKO.1 369 CDS 100% 2.160 1.728 N YKT6 n/a
8 TRCN0000059767 ACAGTCTAAAGCCTTCTATAA pLKO.1 695 CDS 100% 13.200 9.240 N YKT6 n/a
9 TRCN0000299712 ACAGTCTAAAGCCTTCTATAA pLKO_005 695 CDS 100% 13.200 9.240 N YKT6 n/a
10 TRCN0000059765 GAGAAGCTGATCCCATGACTA pLKO.1 559 CDS 100% 4.950 3.465 N YKT6 n/a
11 TRCN0000299713 GAGAAGCTGATCCCATGACTA pLKO_005 559 CDS 100% 4.950 3.465 N YKT6 n/a
12 TRCN0000059763 GCCGAACTAGATGAGACCAAA pLKO.1 588 CDS 100% 4.950 3.465 N YKT6 n/a
13 TRCN0000299711 GCCGAACTAGATGAGACCAAA pLKO_005 588 CDS 100% 4.950 3.465 N YKT6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006555.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02497 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02497 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468086 CGCTCACTGGTGGACACGGGAACG pLX_317 51.4% 100% 100% V5 n/a
Download CSV