Transcript: Human NM_001271889.2

Homo sapiens calcium and integrin binding family member 2 (CIB2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
CIB2 (10518)
Length:
1352
CDS:
231..647

Additional Resources:

NCBI RefSeq record:
NM_001271889.2
NBCI Gene record:
CIB2 (10518)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001271889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039596 CGAGAGCTCAAGGCAAACTAT pLKO.1 393 CDS 100% 5.625 7.875 N CIB2 n/a
2 TRCN0000332967 CGAGAGCTCAAGGCAAACTAT pLKO_005 393 CDS 100% 5.625 7.875 N CIB2 n/a
3 TRCN0000039597 GAACCTCACTTTCAACGACTT pLKO.1 335 CDS 100% 4.050 3.240 N CIB2 n/a
4 TRCN0000039593 GTCCTTTCCTACTCCAGAAAT pLKO.1 912 3UTR 100% 13.200 9.240 N CIB2 n/a
5 TRCN0000332968 GTCCTTTCCTACTCCAGAAAT pLKO_005 912 3UTR 100% 13.200 9.240 N CIB2 n/a
6 TRCN0000018334 CTGACTTCGAGGACATGATTG pLKO.1 583 CDS 100% 10.800 7.560 N CIB2 n/a
7 TRCN0000344569 CTGACTTCGAGGACATGATTG pLKO_005 583 CDS 100% 10.800 7.560 N CIB2 n/a
8 TRCN0000039594 GCTGACTTCGAGGACATGATT pLKO.1 582 CDS 100% 5.625 3.938 N CIB2 n/a
9 TRCN0000104786 CAAGGCAAACTATGCCTTCAA pLKO.1 401 CDS 100% 0.495 0.347 N Cib2 n/a
10 TRCN0000010368 CCTCCTTCACAATGTGAAGCT pLKO.1 1139 3UTR 100% 0.264 0.185 N CIB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001271889.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14049 pDONR223 100% 91.9% 85.4% None (many diffs) n/a
2 ccsbBroad304_14049 pLX_304 0% 91.9% 85.4% V5 (many diffs) n/a
3 TRCN0000474105 ACATTCCCCCCTCAATTCTAAAAC pLX_317 61% 91.9% 85.4% V5 (many diffs) n/a
4 ccsbBroadEn_07627 pDONR223 100% 73.6% 73.7% None 50_51ins147;330C>T n/a
5 ccsbBroad304_07627 pLX_304 0% 73.6% 73.7% V5 50_51ins147;330C>T n/a
6 TRCN0000473152 CAACACTATTGGGCCTTTGGGCAC pLX_317 77.2% 73.6% 73.7% V5 50_51ins147;330C>T n/a
Download CSV