Transcript: Human XR_924181.3

PREDICTED: Homo sapiens polyhomeotic homolog 3 (PHC3), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHC3 (80012)
Length:
3275
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_924181.3
NBCI Gene record:
PHC3 (80012)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_924181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415999 CGACATGCTGTACAGGTAATT pLKO_005 196 3UTR 100% 13.200 18.480 N PHC3 n/a
2 TRCN0000143157 CAAGTCAGTCTCCTACTATAA pLKO.1 1283 3UTR 100% 13.200 9.240 N PHC3 n/a
3 TRCN0000415622 GGAATCGTAAGCCTGATAATC pLKO_005 2588 3UTR 100% 13.200 9.240 N Phc3 n/a
4 TRCN0000140887 GCCAGGATATCGCAGATGAAT pLKO.1 3176 3UTR 100% 5.625 3.938 N PHC3 n/a
5 TRCN0000139508 CCACAGATCCTAACCCATGTT pLKO.1 2209 3UTR 100% 4.950 3.465 N PHC3 n/a
6 TRCN0000139438 CCAGTGGAAGACCATCTACAT pLKO.1 377 3UTR 100% 4.950 3.465 N PHC3 n/a
7 TRCN0000139200 CCTTGCAGTCTATGCAGTCTT pLKO.1 1616 3UTR 100% 4.950 3.465 N PHC3 n/a
8 TRCN0000142291 GCAGTATTACCCAACAGACTA pLKO.1 515 3UTR 100% 4.950 3.465 N PHC3 n/a
9 TRCN0000140669 CAACAGCACTTGATGCTGCAT pLKO.1 283 3UTR 100% 0.264 0.185 N PHC3 n/a
10 TRCN0000441135 CACAGACTGTTGCGGTAAATC pLKO_005 1760 3UTR 100% 13.200 9.240 N Phc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_924181.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15997 pDONR223 0% 11.8% None (many diffs) n/a
2 ccsbBroad304_15997 pLX_304 0% 11.8% V5 (many diffs) n/a
3 TRCN0000473121 TTTTTCCGCTAGGGCAAAAGAACA pLX_317 96% 11.8% V5 (many diffs) n/a
Download CSV