Transcript: Human NM_001160007.2

Homo sapiens neuregulin 1 (NRG1), transcript variant HRG-gamma3, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
NRG1 (3084)
Length:
1491
CDS:
417..950

Additional Resources:

NCBI RefSeq record:
NM_001160007.2
NBCI Gene record:
NRG1 (3084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435384 GATATCACAGAGGCCTATAAC pLKO_005 1255 3UTR 100% 13.200 9.240 N NRG1 n/a
2 TRCN0000416939 GGCTGATTCTGGAGAGTATAT pLKO_005 728 CDS 100% 13.200 9.240 N NRG1 n/a
3 TRCN0000435098 GAAATCCTGTGTGTCGCTTAT pLKO_005 956 3UTR 100% 10.800 7.560 N NRG1 n/a
4 TRCN0000058304 CGGTGTGAAACCAGTTCTGAA pLKO.1 582 CDS 100% 4.950 3.465 N NRG1 n/a
5 TRCN0000058307 TCATGGTGAAAGACCTTTCAA pLKO.1 904 CDS 100% 0.563 0.394 N NRG1 n/a
6 TRCN0000444018 GACAGTGCCTCTGCCAATATC pLKO_005 777 CDS 100% 13.200 7.920 N NRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160007.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15442 pDONR223 0% 73.3% 72.6% None 113G>A;400_401ins102;531_532ins90 n/a
2 ccsbBroad304_15442 pLX_304 0% 73.3% 72.6% V5 113G>A;400_401ins102;531_532ins90 n/a
3 TRCN0000474665 AGGGGATGGAGGTTCGACCCTCTC pLX_317 66.2% 73.3% 72.6% V5 113G>A;400_401ins102;531_532ins90 n/a
Download CSV