Transcript: Human NM_004078.3

Homo sapiens cysteine and glycine rich protein 1 (CSRP1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
CSRP1 (1465)
Length:
1820
CDS:
56..637

Additional Resources:

NCBI RefSeq record:
NM_004078.3
NBCI Gene record:
CSRP1 (1465)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_004078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118077 GCCACATATCACTAATGACTT pLKO.1 740 3UTR 100% 4.950 6.930 N CSRP1 n/a
2 TRCN0000291235 GCCACATATCACTAATGACTT pLKO_005 740 3UTR 100% 4.950 6.930 N CSRP1 n/a
3 TRCN0000118081 CCGTGCATGGTGAGGAGATTT pLKO.1 204 CDS 100% 13.200 9.240 N CSRP1 n/a
4 TRCN0000307652 CCGTGCATGGTGAGGAGATTT pLKO_005 204 CDS 100% 13.200 9.240 N CSRP1 n/a
5 TRCN0000118079 GTGTCAGAAGACGGTTTACTT pLKO.1 91 CDS 100% 5.625 3.938 N CSRP1 n/a
6 TRCN0000307650 GTGTCAGAAGACGGTTTACTT pLKO_005 91 CDS 100% 5.625 3.938 N CSRP1 n/a
7 TRCN0000118080 CTGCAAAGGATGTTATGCTAA pLKO.1 553 CDS 100% 4.950 3.465 N CSRP1 n/a
8 TRCN0000118078 GCGAGATTTACTGCAAAGGAT pLKO.1 543 CDS 100% 3.000 2.100 N CSRP1 n/a
9 TRCN0000291234 GCGAGATTTACTGCAAAGGAT pLKO_005 543 CDS 100% 3.000 2.100 N CSRP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_004078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06059 pDONR223 100% 99.8% 99.4% None 209G>T n/a
2 ccsbBroad304_06059 pLX_304 0% 99.8% 99.4% V5 209G>T n/a
3 TRCN0000476287 TCAGTTGTACACACGCTATTCCTC pLX_317 40.7% 99.8% 99.4% V5 209G>T n/a
Download CSV