Transcript: Human NM_001204746.2

Homo sapiens cadherin 16 (CDH16), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CDH16 (1014)
Length:
2564
CDS:
96..2294

Additional Resources:

NCBI RefSeq record:
NM_001204746.2
NBCI Gene record:
CDH16 (1014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001204746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000437874 ATTCCCATGGCGAGGACTATG pLKO_005 733 CDS 100% 10.800 15.120 N CDH16 n/a
2 TRCN0000435688 TCGCAGTCACAGATATCAATG pLKO_005 1114 CDS 100% 10.800 15.120 N CDH16 n/a
3 TRCN0000055617 CCCTTTATACCTGACCAAGTT pLKO.1 206 CDS 100% 4.950 3.960 N CDH16 n/a
4 TRCN0000055616 CTCTGCAAGAACCTCAGTTAT pLKO.1 1344 CDS 100% 13.200 9.240 N CDH16 n/a
5 TRCN0000417931 CCAATTCCCACGTTGTGTATC pLKO_005 910 CDS 100% 10.800 7.560 N CDH16 n/a
6 TRCN0000055615 CCTGGTGATCCACTTCCTAAA pLKO.1 1757 CDS 100% 10.800 7.560 N CDH16 n/a
7 TRCN0000055614 CCTGGTAGCAATAGGAATCTT pLKO.1 2183 CDS 100% 5.625 3.938 N CDH16 n/a
8 TRCN0000055613 GCAGAGAATCTCAAAGTCCTA pLKO.1 543 CDS 100% 2.640 1.848 N CDH16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001204746.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00275 pDONR223 100% 88.2% 88.2% None 359_360ins291 n/a
2 ccsbBroad304_00275 pLX_304 0% 88.2% 88.2% V5 359_360ins291 n/a
3 TRCN0000468786 GCCAACTAATATAGAGAACTTCTC pLX_317 4% 88.2% 88.2% V5 359_360ins291 n/a
Download CSV