Transcript: Human NR_046223.2

Homo sapiens Rho guanine nucleotide exchange factor 25 (ARHGEF25), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ARHGEF25 (115557)
Length:
2584
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046223.2
NBCI Gene record:
ARHGEF25 (115557)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230916 ATGAGTGGCACCGAGACTATT pLKO_005 1131 3UTR 100% 13.200 18.480 N ARHGEF25 n/a
2 TRCN0000230917 CAAGGCTGGGAGGGATATCAA pLKO_005 2350 3UTR 100% 5.625 4.500 N ARHGEF25 n/a
3 TRCN0000230915 GCAGATTGTGGAGGGTTATAT pLKO_005 1030 3UTR 100% 15.000 10.500 N ARHGEF25 n/a
4 TRCN0000021612 GTTTGGGAATATCCAGCAAAT pLKO.1 1108 3UTR 100% 10.800 7.560 N ARHGEF25 n/a
5 TRCN0000021610 GCTCTGGAAAGGAGTATGTAT pLKO.1 959 3UTR 100% 5.625 3.938 N ARHGEF25 n/a
6 TRCN0000021613 AGACTTGCCAAGCTGGATGAA pLKO.1 2201 3UTR 100% 4.950 3.465 N ARHGEF25 n/a
7 TRCN0000021611 GCCTGGATATGTATACAAGAA pLKO.1 1699 3UTR 100% 4.950 3.465 N ARHGEF25 n/a
8 TRCN0000217997 AGGATTGTGTTTGGGAATATC pLKO_005 1100 3UTR 100% 13.200 7.920 N ARHGEF25 n/a
9 TRCN0000021609 CGGTGTCTGAAAGATCCTGAT pLKO.1 1169 3UTR 100% 4.050 2.430 N ARHGEF25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046223.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13049 pDONR223 100% 54.9% None (many diffs) n/a
2 ccsbBroad304_13049 pLX_304 0% 54.9% V5 (many diffs) n/a
3 TRCN0000480524 AAAGTCTAGGAAATCGATCGGCCC pLX_317 25.3% 54.9% V5 (many diffs) n/a
Download CSV