Construct: ORF TRCN0000480524
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF015306.1_s317c1
- Derived from:
- ccsbBroadEn_13049
- DNA Barcode:
- AAAGTCTAGGAAATCGATCGGCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGEF25 (115557)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480524
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 115557 | ARHGEF25 | Rho guanine nucleotide exch... | NM_182947.4 | 81.6% | 81.5% | 1_318del;1116G>A;1517A>G |
2 | human | 115557 | ARHGEF25 | Rho guanine nucleotide exch... | NM_001111270.3 | 76.4% | 76.4% | 1_435del;1233G>A;1634A>G |
3 | human | 115557 | ARHGEF25 | Rho guanine nucleotide exch... | NM_001347933.2 | 76.4% | 76.3% | (many diffs) |
4 | human | 115557 | ARHGEF25 | Rho guanine nucleotide exch... | NR_046223.2 | 54.9% | (many diffs) | |
5 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | XM_006513880.1 | 76.6% | 79.3% | (many diffs) |
6 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | XM_006513881.2 | 76.6% | 79.3% | (many diffs) |
7 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | XM_006513879.3 | 73.9% | 76.6% | (many diffs) |
8 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | XM_006513878.2 | 70.9% | 73.4% | (many diffs) |
9 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | NM_001166413.1 | 67.4% | 69.8% | (many diffs) |
10 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | NM_028027.3 | 66.4% | 68.8% | (many diffs) |
11 | mouse | 52666 | Arhgef25 | Rho guanine nucleotide exch... | XR_871718.2 | 53% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1488
- ORF length:
- 1422
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt ggagccagct ctagccacag gagaggagct gccggaactg accttgctga 121 ccacactgtt ggagggccct ggagataaga cgcagccacc tgaagaggag actttgtccc 181 aagcccctga gagtgaggag gaacagaaga agaaggctct ggaaaggagt atgtatgtcc 241 tgagtgaact ggtagaaaca gagaaaatgt acgtggacga cttggggcag attgtggagg 301 gttatatggc caccatggct gctcaggggg tccccgagag tcttcgaggc cgtgacagga 361 ttgtgtttgg gaatatccag caaatctatg agtggcaccg agactatttc ttgcaagagc 421 tacaacggtg tctgaaagat cctgattggc tggctcagct attcatcaaa cacgagcgcc 481 ggctgcatat gtatgtggtg tactgtcaga ataagcccaa gtcagagcat gtggtgtcag 541 agtttgggga cagctacttt gaggagctcc ggcagcagct ggggcaccgc ctgcagctga 601 acgacctcct catcaaacct gtgcagcgga tcatgaaata ccagctgctg ctcaaggatt 661 ttctcaagta ttacaataga gctgggatgg atactgcaga cctagagcaa gctgtggagg 721 tcatgtgctt tgtgcccaag cgctgcaacg atatgatgac gctggggaga ttgcggggat 781 ttgagggcaa actgactgct caggggaagc tcttgggcca ggacactttc tgggtcaccg 841 agcctgaggc tggagggctg ctatcttccc gaggtcgaga gaggcgcgtc ttcctctttg 901 agcaaatcat catcttcagt gaagccctgg gaggaggagt gagaggtgga acacagcctg 961 gatatgtata caagaacagc attaaggtga gctgcctggg actggagggg aacctccaag 1021 gtgacccttg ccgctttgca ctgacctcca gagggccaga gggtgggatc cagcgctatg 1081 tcctgcaggc tgcagaccct gctatcagtc aggcctggat caagcatgtg gcTCAGATCT 1141 TGGAGAGCCA ACGGGACTTC CTCAACGCAT TGCAGTCACC CATTGAGTAC CAGAGACGGG 1201 AGAGCCAGAC CAACAGCCTG GGGCGGCCAA GAGGGCCTGG AGTGGGGAGC CCTGGAAGAA 1261 TTCGGCTTGG AGATCAGGCC CAGGGCAGCA CACACACACC CATCAATGGC TCTCTCCCCT 1321 CTCTGCTGCT GTCACCCAAA GGGGAGGTGG CCAGAGCCCT CTTGCCACTG GATAAACAGG 1381 CCCTTGGTGA CATCCCCCAG GCTCCCCATG ACTCTCCTCC AGTCTCTCCA ACTCCAAAAA 1441 CCCCTCCCTG CCAAGCCAGA CTTGCCAAGC TGGATGAAGA TGAGCTGTAC CCAACTTTCT 1501 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1561 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1621 GTGGAAAGGA CGAAAAGTCT AGGAAATCGA TCGGCCCACG CGTTAAGTCg acaatcaacc 1681 tctggattac aaaatttgtg aaagatt