Transcript: Human XM_017011932.2

PREDICTED: Homo sapiens brain protein I3 (BRI3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BRI3 (25798)
Length:
740
CDS:
105..554

Additional Resources:

NCBI RefSeq record:
XM_017011932.2
NBCI Gene record:
BRI3 (25798)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017011932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005342 GCCAACTCTATCGTGGTCGTA pLKO.1 349 CDS 100% 2.640 3.696 N BRI3 n/a
2 TRCN0000005343 CCCGCTATCCTGCCAACTCTA pLKO.1 338 CDS 100% 1.650 2.310 N BRI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017011932.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07944 pDONR223 100% 65.5% 31.5% None (many diffs) n/a
2 ccsbBroad304_07944 pLX_304 0% 65.5% 31.5% V5 (many diffs) n/a
3 TRCN0000481485 TCGCATAATTGTACTGTGCAGGCG pLX_317 100% 65.5% 31.5% V5 (many diffs) n/a
Download CSV