Transcript: Human XR_921895.3

PREDICTED: Homo sapiens ubiquilin 4 (UBQLN4), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBQLN4 (56893)
Length:
3279
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_921895.3
NBCI Gene record:
UBQLN4 (56893)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_921895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434683 ATCTGATGCGTCACATGATTA pLKO_005 660 3UTR 100% 13.200 18.480 N UBQLN4 n/a
2 TRCN0000435808 GATGTTCAATAGCCCAGAAAT pLKO_005 924 3UTR 100% 13.200 18.480 N UBQLN4 n/a
3 TRCN0000007739 GCGTCCATACTCTCTGGCTTT pLKO.1 488 3UTR 100% 4.050 5.670 N UBQLN4 n/a
4 TRCN0000429002 TCCTTGAGCAGTGCTACTTAA pLKO_005 1820 3UTR 100% 13.200 10.560 N UBQLN4 n/a
5 TRCN0000007740 CCCAAGGACAAGGAGGAAATT pLKO.1 80 3UTR 100% 13.200 9.240 N UBQLN4 n/a
6 TRCN0000415289 GATCAGCCACATGCTCAATAA pLKO_005 724 3UTR 100% 13.200 9.240 N UBQLN4 n/a
7 TRCN0000415096 GCCCAACCAATGCTAGAATTT pLKO_005 2052 3UTR 100% 13.200 9.240 N UBQLN4 n/a
8 TRCN0000425809 AGGAAATCTCCCGGAGGTTTA pLKO_005 138 3UTR 100% 10.800 7.560 N UBQLN4 n/a
9 TRCN0000007738 CCAGAGGAAATTCGTGTGAAA pLKO.1 2262 3UTR 100% 4.950 3.465 N UBQLN4 n/a
10 TRCN0000007741 GCTGCTCAGATGATGGTGAAT pLKO.1 1054 3UTR 100% 4.950 3.465 N UBQLN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_921895.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12308 pDONR223 100% 5.6% None 1_1413del;1600_3279del n/a
2 ccsbBroad304_12308 pLX_304 0% 5.6% V5 1_1413del;1600_3279del n/a
3 TRCN0000475191 CTTGTTGACGTACAAACAAGAGTA pLX_317 100% 5.6% V5 1_1413del;1600_3279del n/a
Download CSV