Transcript: Human NM_005109.3

Homo sapiens oxidative stress responsive kinase 1 (OXSR1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
OXSR1 (9943)
Length:
4517
CDS:
341..1924

Additional Resources:

NCBI RefSeq record:
NM_005109.3
NBCI Gene record:
OXSR1 (9943)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196623 GAGCACTCATAATGCAATATG pLKO.1 3065 3UTR 100% 13.200 18.480 N OXSR1 n/a
2 TRCN0000194994 CGGAAGGGATTTAGTAATAGT pLKO.1 1765 CDS 100% 5.625 4.500 N OXSR1 n/a
3 TRCN0000001586 GCGTATCTCTGTTGCTTCTAT pLKO.1 1967 3UTR 100% 5.625 4.500 N OXSR1 n/a
4 TRCN0000234391 AGGTTCTGTTCTGGATATTAT pLKO_005 631 CDS 100% 15.000 10.500 N OXSR1 n/a
5 TRCN0000234392 TAGCAACTGGTGGTGATATTA pLKO_005 852 CDS 100% 15.000 10.500 N OXSR1 n/a
6 TRCN0000234393 GTAATAGTGGCAGCTAATTTG pLKO_005 1778 CDS 100% 13.200 9.240 N OXSR1 n/a
7 TRCN0000234390 GTGGCAATCAAACGGATAAAC pLKO_005 467 CDS 100% 13.200 9.240 N OXSR1 n/a
8 TRCN0000218998 TGGTCTTTCTAAACGACTAAA pLKO_005 4270 3UTR 100% 13.200 9.240 N OXSR1 n/a
9 TRCN0000001588 GCCATCATCCTAATATTGTAT pLKO.1 549 CDS 100% 5.625 3.938 N OXSR1 n/a
10 TRCN0000001587 GCAGAACTATTAAGGCACAAA pLKO.1 1187 CDS 100% 4.950 3.465 N OXSR1 n/a
11 TRCN0000010643 GTGGAGGTTCTGTTCTGGATA pLKO.1 627 CDS 100% 4.950 3.465 N OXSR1 n/a
12 TRCN0000001589 CCTGATGATGGTAAACTGATA pLKO.1 1877 CDS 100% 4.950 2.970 N OXSR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005109.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14949 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_14949 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468244 TGCTCTTTCACGCTGTCTCTGAAC pLX_317 25.8% 100% 100% V5 n/a
4 TRCN0000489498 AGAGCAACCAAATGCAAACTATGA pLX_317 25.9% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV