Construct: ORF TRCN0000468244
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005780.2_s317c1
- Derived from:
- ccsbBroadEn_14949
- DNA Barcode:
- TGCTCTTTCACGCTGTCTCTGAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- OXSR1 (9943)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468244
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9943 | OXSR1 | oxidative stress responsive... | NM_005109.3 | 100% | 100% | |
| 2 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_011534331.2 | 89.1% | 85.9% | (many diffs) |
| 3 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_017007601.1 | 87% | 83.9% | (many diffs) |
| 4 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_005265638.2 | 83.6% | 82.7% | (many diffs) |
| 5 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_024453852.1 | 63.5% | 63.5% | 0_1ins576 |
| 6 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_024453851.1 | 61.1% | 57.6% | (many diffs) |
| 7 | human | 9943 | OXSR1 | oxidative stress responsive... | XR_001740396.1 | 34.1% | (many diffs) | |
| 8 | human | 9943 | OXSR1 | oxidative stress responsive... | XR_001740397.1 | 33.3% | 1_362del;1314_1509del;2140_4737del | |
| 9 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | NM_133985.2 | 90.5% | 95.8% | (many diffs) |
| 10 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | XM_006511919.3 | 90.5% | 95.8% | (many diffs) |
| 11 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | XM_006511920.2 | 57.6% | 59.7% | (many diffs) |
| 12 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | XM_011242932.2 | 48.6% | 52.5% | (many diffs) |
| 13 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | NR_045693.1 | 29.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1647
- ORF length:
- 1581
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cgaggactcg agcgccctgc cctggtccat caacagggac gattacgagc 121 tgcaggaggt gatcgggagt ggagcaactg ctgtagtcca agcagcttat tgtgccccta 181 aaaaggagaa agtggcaatc aaacggataa accttgagaa atgtcaaact agcatggatg 241 aactcctgaa agaaattcaa gccatgagtc aatgccatca tcctaatatt gtatcttact 301 acacatcttt tgtggtaaaa gatgagctgt ggcttgtcat gaagctgcta agtggaggtt 361 ctgttctgga tattattaag cacattgtgg caaaagggga acacaaaagt ggagtcctag 421 atgaatctac cattgctacg atactccgag aagtactgga agggctggaa tatctgcata 481 aaaatggaca gatccacaga gatgtgaaag ctggaaacat tcttcttgga gaagatggct 541 cagtacagat tgcagacttt ggggttagtg cttttttagc aactggtggt gatattaccc 601 gaaataaagt gagaaagacc tttgttggca ccccttgttg gatggcacct gaagttatgg 661 aacaggtccg tggttatgat ttcaaagctg atatttggag ttttggaatt acagcaattg 721 aattggctac aggggcggct ccttatcata aatatccacc aatgaaggtt ttaatgctga 781 cactgcagaa cgatcctcct tctttggaaa ctggtgttca agataaagaa atgctgaaaa 841 aatatggaaa atcatttaga aaaatgattt cattgtgcct tcaaaaagat ccagaaaaaa 901 gaccaacagc agcagaacta ttaaggcaca aatttttcca gaaagcaaag aataaagaat 961 ttcttcaaga aaaaacattg cagagagcac caaccatttc tgaaagagca aaaaaggttc 1021 ggagagtacc aggttccagt gggcgtcttc ataagacaga ggatggaggc tgggagtgga 1081 gtgatgatga atttgatgaa gaaagtgagg aagggaaagc agcaatttca caactcaggt 1141 ctccccgagt gaaagaatca atatcaaatt ctgagctctt tccaacaact gatcctgtgg 1201 gtactttgct ccaagttcca gaacagatct ctgctcatct accTCAGCCA GCTGGGCAGA 1261 TTGCTACACA GCCAACTCAA GTCTCTCTCC CACCCACCGC AGAGCCAGCA AAAACAGCTC 1321 AGGCTTTGTC TTCAGGATCA GGTTCACAAG AAACCAAGAT CCCAATCAGT CTAGTACTAA 1381 GATTAAGGAA TTCCAAAAAA GAACTAAATG ATATTCGATT TGAATTTACT CCTGGGAGAG 1441 ATACAGCAGA GGGTGTCTCT CAGGAACTCA TTTCTGCTGG CCTGGTCGAC GGAAGGGATT 1501 TAGTAATAGT GGCAGCTAAT TTGCAGAAAA TTGTGGAAGA ACCTCAGTCA AATCGATCTG 1561 TCACTTTCAA ACTGGCATCT GGTGTCGAAG GCTCAGATAT TCCTGATGAT GGTAAACTGA 1621 TAGGATTTGC CCAGCTCAGC ATCAGCTACA CAACTTTCTT GTACAAAGTG GTTGATATCG 1681 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1741 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATGCTCTTT 1801 CACGCTGTCT CTGAACACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1861 aagatt