Construct: ORF TRCN0000489498
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF020144.1_s317c1
- DNA Barcode:
- AGAGCAACCAAATGCAAACTATGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Has stop codon in insert
Originally Annotated References:
- Gene:
- OXSR1 (9943)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489498
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9943 | OXSR1 | oxidative stress responsive... | NM_005109.3 | 100% | 100% | |
| 2 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_011534331.2 | 89.1% | 85.9% | (many diffs) |
| 3 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_017007601.1 | 87% | 83.9% | (many diffs) |
| 4 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_005265638.2 | 83.6% | 82.7% | (many diffs) |
| 5 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_024453852.1 | 63.5% | 63.5% | 0_1ins576 |
| 6 | human | 9943 | OXSR1 | oxidative stress responsive... | XM_024453851.1 | 61.1% | 57.6% | (many diffs) |
| 7 | human | 9943 | OXSR1 | oxidative stress responsive... | XR_001740396.1 | 34.1% | (many diffs) | |
| 8 | human | 9943 | OXSR1 | oxidative stress responsive... | XR_001740397.1 | 33.3% | 1_362del;1314_1509del;2140_4737del | |
| 9 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | NM_133985.2 | 90.5% | 95.8% | (many diffs) |
| 10 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | XM_006511919.3 | 90.5% | 95.8% | (many diffs) |
| 11 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | XM_006511920.2 | 57.6% | 59.7% | (many diffs) |
| 12 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | XM_011242932.2 | 48.6% | 52.5% | (many diffs) |
| 13 | mouse | 108737 | Oxsr1 | oxidative-stress responsive 1 | NR_045693.1 | 29.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 72
- ORF end:
- 1653
- ORF length:
- 1581
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 caggcttcac catgtccgag gactcgagcg ccctgccctg gtccatcaac agggacgatt 121 acgagctgca ggaggtgatc gggagtggag caactgctgt agtccaagca gcttattgtg 181 cccctaaaaa ggagaaagtg gcaatcaaac ggataaacct tgagaaatgt caaactagca 241 tggatgaact cctgaaagaa attcaagcca tgagtcaatg ccatcatcct aatattgtat 301 cttactacac atcttttgtg gtaaaagatg agctgtggct tgtcatgaag ctgctaagtg 361 gaggttctgt tctggatatt attaagcaca ttgtggcaaa aggggaacac aaaagtggag 421 tcctagatga atctaccatt gctacgatac tccgagaagt actggaaggg ctggaatatc 481 tgcataaaaa tggacagatc cacagagatg tgaaagctgg aaacattctt cttggagaag 541 atggctcagt acagattgca gactttgggg ttagtgcttt tttagcaact ggtggtgata 601 ttacccgaaa taaagtgaga aagacctttg ttggcacccc ttgttggatg gcacctgaag 661 ttatggaaca ggtccgtggt tatgatttca aagctgatat ttggagtttt ggaattacag 721 caattgaatt ggctacaggg gcggctcctt atcataaata tccaccaatg aaggttttaa 781 tgctgacact gcagaacgat cctccttctt tggaaactgg tgttcaagat aaagaaatgc 841 tgaaaaaata tggaaaatca tttagaaaaa tgatttcatt gtgccttcaa aaagatccag 901 aaaaaagacc aacagcagca gaactattaa ggcacaaatt tttccagaaa gcaaagaata 961 aagaatttct tcaagaaaaa acattgcaga gagcaccaac catttctgaa agagcaaaaa 1021 aggttcggag agtaccaggt tccagtgggc gtcttcataa gacagaggat ggaggctggg 1081 agtggagtga tgatgaattt gatgaagaaa gtgaggaagg gaaagcagca atttcacaac 1141 tcaggtctcc ccgagtgaaa gaatcaatat caaattctga gctctttcca acaactgatc 1201 ctgtgggtac tttgctccaa gttccagaac agatctctgc tcatctaccT CAGCCAGCTG 1261 GGCAGATTGC TACACAGCCA ACTCAAGTCT CTCTCCCACC CACCGCAGAG CCAGCAAAAA 1321 CAGCTCAGGC TTTGTCTTCA GGATCAGGTT CACAAGAAAC CAAGATCCCA ATCAGTCTAG 1381 TACTAAGATT AAGGAATTCC AAAAAAGAAC TAAATGATAT TCGATTTGAA TTTACTCCTG 1441 GGAGAGATAC AGCAGAGGGT GTCTCTCAGG AACTCATTTC TGCTGGCCTG GTCGACGGAA 1501 GGGATTTAGT AATAGTGGCA GCTAATTTGC AGAAAATTGT GGAAGAACCT CAGTCAAATC 1561 GATCTGTCAC TTTCAAACTG GCATCTGGTG TCGAAGGCTC AGATATTCCT GATGATGGTA 1621 AACTGATAGG ATTTGCCCAG CTCAGCATCA GCTGAGACCC AGCTTTCTTG TACAAAGTGG 1681 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1741 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1801 AAGAGCAACC AAATGCAAAC TATGAACGCG TTAAGTCgac aatcaacctc tggattacaa 1861 aatttgtgaa agatt