Transcript: Human XR_001743620.2

PREDICTED: Homo sapiens zinc finger protein 76 (ZNF76), transcript variant X18, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF76 (7629)
Length:
2811
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001743620.2
NBCI Gene record:
ZNF76 (7629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001743620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233078 ACCACCGCTCATCACTTAAAG pLKO_005 877 3UTR 100% 13.200 18.480 N ZNF76 n/a
2 TRCN0000020285 CGAGTACTCGAGCTTGTATAA pLKO.1 1329 3UTR 100% 0.000 0.000 N ZNF76 n/a
3 TRCN0000020286 CACCACATCTAACATCCGCAA pLKO.1 1146 3UTR 100% 2.160 1.728 N ZNF76 n/a
4 TRCN0000233081 CCTGACACCACAGTCAATTAA pLKO_005 2562 3UTR 100% 15.000 10.500 N ZNF76 n/a
5 TRCN0000233079 TCACCAGCGCCACCAACTATA pLKO_005 1235 3UTR 100% 13.200 9.240 N ZNF76 n/a
6 TRCN0000233077 ATGGCTCCACTGCCTACATTC pLKO_005 623 3UTR 100% 10.800 7.560 N ZNF76 n/a
7 TRCN0000020284 CATCACTTAAAGGTGCATGAA pLKO.1 886 3UTR 100% 4.950 3.465 N ZNF76 n/a
8 TRCN0000020288 AGCTTACCTTTCGGAGGTGAA pLKO.1 1560 3UTR 100% 4.050 2.835 N ZNF76 n/a
9 TRCN0000020287 CTGAGGACTCAAGTGTAGCAT pLKO.1 1887 3UTR 100% 3.000 1.800 N ZNF76 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001743620.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01806 pDONR223 100% 60.7% None (many diffs) n/a
2 ccsbBroad304_01806 pLX_304 0% 60.7% V5 (many diffs) n/a
3 TRCN0000478143 GGAATGATGAAACTACCTCACAGC pLX_317 9.9% 60.7% V5 (many diffs) n/a
Download CSV