Transcript: Human NM_006093.4

Homo sapiens proteoglycan 3, pro eosinophil major basic protein 2 (PRG3), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
PRG3 (10394)
Length:
869
CDS:
111..788

Additional Resources:

NCBI RefSeq record:
NM_006093.4
NBCI Gene record:
PRG3 (10394)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006093.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073488 CCTATGCACCAAAGGAGGTTA pLKO.1 716 CDS 100% 4.950 6.930 N PRG3 n/a
2 TRCN0000073489 CATGACTTCAACTTCAACTAT pLKO.1 528 CDS 100% 5.625 3.938 N PRG3 n/a
3 TRCN0000073491 TCTGCCTGTCAAGACAACTTT pLKO.1 309 CDS 100% 5.625 3.938 N PRG3 n/a
4 TRCN0000073492 CCATGACTTCAACTTCAACTA pLKO.1 527 CDS 100% 4.950 3.465 N PRG3 n/a
5 TRCN0000073490 GCCAGGATCTGGATAGTTCAA pLKO.1 220 CDS 100% 4.950 2.970 N PRG3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006093.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07595 pDONR223 100% 99.7% 99.1% None 7T>C;326T>C n/a
2 ccsbBroad304_07595 pLX_304 0% 99.7% 99.1% V5 7T>C;326T>C n/a
3 TRCN0000473944 GCTCACTAAAAGAAACGGACATCT pLX_317 61.7% 99.7% 99.1% V5 7T>C;326T>C n/a
Download CSV