Transcript: Human NM_022131.3

Homo sapiens calsyntenin 2 (CLSTN2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CLSTN2 (64084)
Length:
14202
CDS:
191..3058

Additional Resources:

NCBI RefSeq record:
NM_022131.3
NBCI Gene record:
CLSTN2 (64084)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_022131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054221 CCTCGCGGCTAAAGTCAATAA pLKO.1 286 CDS 100% 13.200 18.480 N CLSTN2 n/a
2 TRCN0000446439 GACGATTCTGCGCTGACTATC pLKO_005 2819 CDS 100% 10.800 15.120 N CLSTN2 n/a
3 TRCN0000415532 TGATGGAAGGTGACGACATTG pLKO_005 1896 CDS 100% 10.800 15.120 N CLSTN2 n/a
4 TRCN0000054219 CGTGGTCCATATACAGGTGAA pLKO.1 622 CDS 100% 4.050 5.670 N CLSTN2 n/a
5 TRCN0000054218 CGCCTCAAAGTATCCTCCAAA pLKO.1 1988 CDS 100% 4.950 3.465 N CLSTN2 n/a
6 TRCN0000054222 GCGCTACACTAGCAATGAGTT pLKO.1 2518 CDS 100% 4.950 3.465 N CLSTN2 n/a
7 TRCN0000054220 GCTGGATCAGATTTGTGACAA pLKO.1 1525 CDS 100% 4.950 3.465 N CLSTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_022131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12444 pDONR223 100% 99.8% 99.7% None 2283C>T;2540_2541delTCinsAT;2837T>C n/a
2 ccsbBroad304_12444 pLX_304 0% 99.8% 99.7% V5 2283C>T;2540_2541delTCinsAT;2837T>C n/a
3 TRCN0000481401 TAGTCACCGCCTACTTCAGGTGGC pLX_317 14.7% 99.8% 99.7% V5 2283C>T;2540_2541delTCinsAT;2837T>C n/a
Download CSV