Transcript: Human NM_001144026.3

Homo sapiens NADPH dependent diflavin oxidoreductase 1 (NDOR1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
NDOR1 (27158)
Length:
4844
CDS:
79..1899

Additional Resources:

NCBI RefSeq record:
NM_001144026.3
NBCI Gene record:
NDOR1 (27158)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001144026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046428 CCCGGTGGTGAATCTGATTAA pLKO.1 207 CDS 100% 13.200 18.480 N NDOR1 n/a
2 TRCN0000046430 GAAGAACTTCTGGAGGTTTAT pLKO.1 288 CDS 100% 13.200 9.240 N NDOR1 n/a
3 TRCN0000414256 ATATTTGTTTGTGCAACTACA pLKO_005 241 CDS 100% 4.950 3.465 N NDOR1 n/a
4 TRCN0000046429 CCAGACTGGAAACTTCTTGTT pLKO.1 1506 CDS 100% 4.950 3.465 N NDOR1 n/a
5 TRCN0000437282 GGAAGCCCTGATGTCCATCTT pLKO_005 1785 CDS 100% 4.950 3.465 N NDOR1 n/a
6 TRCN0000445866 GGACTCCTCATACGCCAAGTT pLKO_005 372 CDS 100% 4.950 3.465 N NDOR1 n/a
7 TRCN0000046432 GCAGAAAGTATATGTGCAGCA pLKO.1 1662 CDS 100% 2.160 1.512 N NDOR1 n/a
8 TRCN0000046431 GCAGTTCCAGACTCGCCTCAA pLKO.1 1290 CDS 100% 1.350 0.945 N NDOR1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001144026.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08064 pDONR223 100% 98.4% 98.3% None 1551_1577del;1591G>A n/a
2 ccsbBroad304_08064 pLX_304 0% 98.4% 98.3% V5 1551_1577del;1591G>A n/a
Download CSV