Transcript: Human XR_244222.4

PREDICTED: Homo sapiens PC-esterase domain containing 1A (PCED1A), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PCED1A (64773)
Length:
1726
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244222.4
NBCI Gene record:
PCED1A (64773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244222.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130377 GAGACTGATCCACACATACAA pLKO.1 1520 3UTR 100% 5.625 7.875 N PCED1A n/a
2 TRCN0000338738 GAGACTGATCCACACATACAA pLKO_005 1520 3UTR 100% 5.625 7.875 N PCED1A n/a
3 TRCN0000128528 CTTCAACTATAATCCAGTGGA pLKO.1 1292 3UTR 100% 2.640 3.696 N PCED1A n/a
4 TRCN0000130092 CTACTTCCTCACTCGTGTTTA pLKO.1 798 3UTR 100% 13.200 9.240 N PCED1A n/a
5 TRCN0000338670 CTACTTCCTCACTCGTGTTTA pLKO_005 798 3UTR 100% 13.200 9.240 N PCED1A n/a
6 TRCN0000130992 CAGAAAGACTCACTGCTCACA pLKO.1 631 3UTR 100% 2.640 1.848 N PCED1A n/a
7 TRCN0000338669 CAGAAAGACTCACTGCTCACA pLKO_005 631 3UTR 100% 2.640 1.848 N PCED1A n/a
8 TRCN0000129522 GCTGCTACACAACAAGTTCGT pLKO.1 552 3UTR 100% 2.640 1.848 N PCED1A n/a
9 TRCN0000338668 GCTGCTACACAACAAGTTCGT pLKO_005 552 3UTR 100% 2.640 1.848 N PCED1A n/a
10 TRCN0000131185 GCTACACAACAAGTTCGTGGT pLKO.1 555 3UTR 100% 2.160 1.512 N PCED1A n/a
11 TRCN0000129588 CACTCGTGTTTACTCCGAGTA pLKO.1 807 3UTR 100% 0.405 0.284 N PCED1A n/a
12 TRCN0000129108 CACACATACAAACTGGACAGA pLKO.1 1530 3UTR 100% 2.640 1.584 N PCED1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244222.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03965 pDONR223 100% 56.5% None 1_468del;1061_1062ins247;1584_1726del n/a
2 ccsbBroad304_03965 pLX_304 0% 56.5% V5 1_468del;1061_1062ins247;1584_1726del n/a
3 TRCN0000480929 CCAGCATTACTCGATATCGGTGCA pLX_317 28% 56.5% V5 1_468del;1061_1062ins247;1584_1726del n/a
Download CSV