Transcript: Human NM_001135051.2

Homo sapiens family with sequence similarity 160 member B1 (FAM160B1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
FAM160B1 (57700)
Length:
2834
CDS:
300..2516

Additional Resources:

NCBI RefSeq record:
NM_001135051.2
NBCI Gene record:
FAM160B1 (57700)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001135051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365543 CCTTTAAGGCATAGGTTAATT pLKO_005 1650 CDS 100% 15.000 21.000 N FAM160B1 n/a
2 TRCN0000129553 CGGGAATGAAACAGCAGGTTT pLKO.1 601 CDS 100% 4.950 6.930 N FAM160B1 n/a
3 TRCN0000130612 CTGGAAGGCAATTACCCATTA pLKO.1 386 CDS 100% 10.800 8.640 N FAM160B1 n/a
4 TRCN0000131161 GCCTCGGTTGTTTGTCCAAAT pLKO.1 1047 CDS 100% 10.800 8.640 N FAM160B1 n/a
5 TRCN0000370759 TCTGGAAGAAGATCCATTATT pLKO_005 1871 CDS 100% 15.000 10.500 N FAM160B1 n/a
6 TRCN0000365611 TTGGACTCATATAGTCATAAA pLKO_005 1314 CDS 100% 13.200 9.240 N FAM160B1 n/a
7 TRCN0000131059 CAGAGGAACTATCTGGTGCTA pLKO.1 928 CDS 100% 2.640 1.848 N FAM160B1 n/a
8 TRCN0000129385 GAACCAGAAACTCTGGCAGAA pLKO.1 1617 CDS 100% 4.050 2.430 N FAM160B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135051.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08761 pDONR223 100% 99.9% 99.8% None 1222C>A n/a
2 ccsbBroad304_08761 pLX_304 0% 99.9% 99.8% V5 1222C>A n/a
3 TRCN0000465820 TTCTAATCCAAGTCATCCATAGCT pLX_317 19.7% 99.9% 99.8% V5 1222C>A n/a
Download CSV