Transcript: Human NR_028491.3

Homo sapiens transmembrane protein 41B (TMEM41B), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
TMEM41B (440026)
Length:
1469
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_028491.3
NBCI Gene record:
TMEM41B (440026)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_028491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158852 GTTGAACGTCATAGAGAACAT pLKO.1 720 3UTR 100% 4.950 6.930 N TMEM41B n/a
2 TRCN0000344438 GTTGAACGTCATAGAGAACAT pLKO_005 720 3UTR 100% 4.950 6.930 N TMEM41B n/a
3 TRCN0000159112 GTTTCCTGGAACTCAATATTT pLKO.1 933 3UTR 100% 15.000 10.500 N TMEM41B n/a
4 TRCN0000344439 GTTTCCTGGAACTCAATATTT pLKO_005 933 3UTR 100% 15.000 10.500 N TMEM41B n/a
5 TRCN0000160208 CCTAACAGAGAAAGCAGTAAA pLKO.1 686 3UTR 100% 13.200 9.240 N TMEM41B n/a
6 TRCN0000344437 CCTAACAGAGAAAGCAGTAAA pLKO_005 686 3UTR 100% 13.200 9.240 N TMEM41B n/a
7 TRCN0000159035 GAACAACACTGTATCAACTTA pLKO.1 895 3UTR 100% 5.625 3.938 N TMEM41B n/a
8 TRCN0000160983 GCAGGAACAACACTGTATCAA pLKO.1 891 3UTR 100% 5.625 3.938 N TMEM41B n/a
9 TRCN0000158584 CCTCTTTCTGTTATATGCTTT pLKO.1 631 3UTR 100% 4.950 3.465 N TMEM41B n/a
10 TRCN0000160235 CGTCATAGAGAACATCTCATT pLKO.1 726 3UTR 100% 4.950 3.465 N TMEM41B n/a
11 TRCN0000159250 GCCCATGTAAATTCAAGCTTT pLKO.1 1238 3UTR 100% 4.950 3.465 N TMEM41B n/a
12 TRCN0000344440 GCCCATGTAAATTCAAGCTTT pLKO_005 1238 3UTR 100% 4.950 3.465 N TMEM41B n/a
13 TRCN0000158853 GAATAACACCATTTCTGCCTA pLKO.1 766 3UTR 100% 2.640 1.848 N TMEM41B n/a
14 TRCN0000165600 GACTGTCAAGAAAGGACCCTT pLKO.1 1152 3UTR 100% 2.640 1.848 N TMEM41B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_028491.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13686 pDONR223 100% 38.5% None 1_152del;520_521insTTACCAG;722_1469del n/a
2 ccsbBroad304_13686 pLX_304 0% 38.5% V5 1_152del;520_521insTTACCAG;722_1469del n/a
3 TRCN0000476364 GATATCAAAAAACTAAAAACATCT pLX_317 60.1% 38.5% V5 1_152del;520_521insTTACCAG;722_1469del n/a
Download CSV