Transcript: Human NM_001354590.2

Homo sapiens fragile histidine triad diadenosine triphosphatase (FHIT), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
FHIT (2272)
Length:
3047
CDS:
365..739

Additional Resources:

NCBI RefSeq record:
NM_001354590.2
NBCI Gene record:
FHIT (2272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001354590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379422 TGTCCTTCGCTCTTGTGAATA pLKO_005 426 CDS 100% 13.200 18.480 N FHIT n/a
2 TRCN0000303423 TCATCTCACCATCCTGTATTC pLKO_005 854 3UTR 100% 10.800 7.560 N FHIT n/a
3 TRCN0000051177 CCCTCTGTAGTGTTTCTCAAA pLKO.1 398 CDS 100% 4.950 3.465 N FHIT n/a
4 TRCN0000299003 CCCTCTGTAGTGTTTCTCAAA pLKO_005 398 CDS 100% 4.950 3.465 N FHIT n/a
5 TRCN0000051174 CTTGGAGATCAGAGGAGGAAA pLKO.1 678 CDS 100% 4.950 3.465 N FHIT n/a
6 TRCN0000051175 GTGAATAGGAAACCTGTGGTA pLKO.1 440 CDS 100% 2.640 1.848 N FHIT n/a
7 TRCN0000051176 CGTCCTGATGAAGTGGCCGAT pLKO.1 515 CDS 100% 0.720 0.504 N FHIT n/a
8 TRCN0000380185 GCTATTGCCAACCAGTTTGAA pLKO_005 777 3UTR 100% 5.625 3.375 N FHIT n/a
9 TRCN0000303422 CATGGGACCTCTCTCACCTTT pLKO_005 584 CDS 100% 4.950 2.970 N FHIT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001354590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00566 pDONR223 100% 84.3% 84.3% None 277_278ins69 n/a
2 ccsbBroad304_00566 pLX_304 0% 84.3% 84.3% V5 277_278ins69 n/a
3 TRCN0000468451 GGAAATTAGAAAAGTCTCATCAGG pLX_317 83.7% 84.3% 84.3% V5 277_278ins69 n/a
Download CSV