Transcript: Human NM_001320901.2

Homo sapiens fragile histidine triad diadenosine triphosphatase (FHIT), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-18
Taxon:
Homo sapiens (human)
Gene:
FHIT (2272)
Length:
5472
CDS:
248..523

Additional Resources:

NCBI RefSeq record:
NM_001320901.2
NBCI Gene record:
FHIT (2272)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303423 TCATCTCACCATCCTGTATTC pLKO_005 3279 3UTR 100% 10.800 7.560 N FHIT n/a
2 TRCN0000303421 ACGTTCACGTCCATGTTCTTC pLKO_005 360 CDS 100% 4.950 3.465 N FHIT n/a
3 TRCN0000381605 ATCTATGAGGAGCTCCAGAAA pLKO_005 416 CDS 100% 4.950 3.465 N FHIT n/a
4 TRCN0000051174 CTTGGAGATCAGAGGAGGAAA pLKO.1 462 CDS 100% 4.950 3.465 N FHIT n/a
5 TRCN0000051173 GCTGGAGACTTTCACAGGAAT pLKO.1 389 CDS 100% 4.950 3.465 N FHIT n/a
6 TRCN0000299004 GCTGGAGACTTTCACAGGAAT pLKO_005 389 CDS 100% 4.950 3.465 N FHIT n/a
7 TRCN0000380185 GCTATTGCCAACCAGTTTGAA pLKO_005 3202 3UTR 100% 5.625 3.375 N FHIT n/a
8 TRCN0000303422 CATGGGACCTCTCTCACCTTT pLKO_005 299 CDS 100% 4.950 2.970 N FHIT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320901.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00566 pDONR223 100% 61.4% 59.1% None (many diffs) n/a
2 ccsbBroad304_00566 pLX_304 0% 61.4% 59.1% V5 (many diffs) n/a
3 TRCN0000468451 GGAAATTAGAAAAGTCTCATCAGG pLX_317 83.7% 61.4% 59.1% V5 (many diffs) n/a
Download CSV